Moderator
Administrator
Member # 1
|
posted 16. October 2005 18:58
Palindromati
by Fernando Castro-Chavez
Abstract: This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be produced by different chromosomes. This happens due to current methodologies producing the reported sequences, found in the Genbank, in Affymetrix microarrays, and in many published articles reporting or using those sequences that include the EcoRI-like linker inside coding regions, and/or 5’UTR or 3’UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts are here deemed as experimental artifacts, characterization that can be helpful to prevent errors, both in the studies of molecular mechanisms and in the drug discovery process.
To read the entire article, click here. To discuss this article, click here. [ 16. October 2005, 19:03: Message edited by: Moderator ]
IP: Logged
|