ISCID Forums
Topic Closed  Topic Closed


Post New Topic  
Topic Closed  Topic Closed
my profile | search | faq | forum home

This topic has been moved to Brainstorms.    
next oldest topic   next newest topic
» ISCID Forums   » General   » The Archive   » Fernando Castro-Chavez: Palindromati

   
Author Topic: Fernando Castro-Chavez: Palindromati
Moderator
Administrator
Member # 1

Icon 1 posted 16. October 2005 18:58      Profile for Moderator   Email Moderator   Send New Private Message       Edit/Delete Post 
Palindromati

by Fernando Castro-Chavez

Abstract: This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be produced by different chromosomes. This happens due to current methodologies producing the reported sequences, found in the Genbank, in Affymetrix microarrays, and in many published articles reporting or using those sequences that include the EcoRI-like linker inside coding regions, and/or 5’UTR or 3’UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts are here deemed as experimental artifacts, characterization that can be helpful to prevent errors, both in the studies of molecular mechanisms and in the drug discovery process.

To read the entire article, click here.
To discuss this article, click here.

[ 16. October 2005, 19:03: Message edited by: Moderator ]

IP: Logged


All times are East Coast  
Post New Topic  
Topic Closed  Topic Closed
Open Topic    Move Topic    Delete Topic    Top Topic next oldest topic   next newest topic
 - Printer-friendly view of this topic
Hop To:

Contact Us | ISCID

All content © ISCID and content contributor 2001-2003

The ISCID Forums are aimed at generating insight into the nature of complex systems (e.g. biological complexity, organizational complexity, etc.) and the ontological status of purpose, especially from the vantage point of various information- and design-theoretic models.

Indexed by UBB Spider Hack  |  Powered by Infopop Corporation UBB.classicTM 6.3.1.1

PCID | Encyclopedia | Brainstorms | The Archive | News | Essay Contests | Chat Events | Membership