posted 16. December 2003 23:35                   

quote:

---

ABSTRACT Several cases have been described in the
literature where genetic polymorphism appears to be shared between a pair of species.

---

quote:

---

Shared polymorphism may be formally defined as follows: suppose species A has two alleles at a locus, A1 and A2, and species B also has two alleles at the homologous locus, labeled B1 and B2. Shared polymorphism occurs if alleles A1 and B1 cluster together and are significantly divergent from alleles A2 and B2, which also cluster together. The biological conclusions to be drawn from shared polymorphism depend on the chance that neutral alleles can exhibit this property. Formally, shared polymorphism may arise either when there was a polymorphism in the population ancestral to the two species examined
today, and that polymorphism has been maintained through the two distinct species’ lineages, or by more recent parallel generation of similar alleles. If the identity of alleles is well described, as is the case for DNA sequences, it may be extremely unlikely that multiple parallel mutations had occurred.

---

quote:

---

Fig. 4 illustrates one way to conceptualize the problem of shared polymorphism in the context of the coalescent. If two species each coalesce to a common ancestral allele more recently than the time at which they share a common ancestor, then there is not shared polymorphism (Fig. 4A). On the other hand, if they do not have this recent coalescence event, then they share polymorphism (Fig. 4B).

---

posted 17. December 2003 12:26                   

quote:

---

This clearly occurred with acceptance of the basic
idea of evolution, that the distribution and resemblances among species are due to their pattern of shared ancestry. This explained so many things naturally, rather than by contorted arguments, that we all now quote Dobzhansky’s dictum that ‘‘nothing in biology makes sense except in the light of evolution.’’ Continental drift, the Copernican astronomy, relativity, spherical geometry, and the atomic model of matter are other examples of transforming paradigm shifts.

---

quote:

---

A second major consequence of the modular nature of DNA and random location of mutations is that there should be many, not two, alleles at any locus. Multiple alleles were of course formally consistent with population genetics theory, but were given little importance in the prevailing adaptionist perspective, except in some easily explicable special cases such as selection for high variation per se in the HLA and immunoglobulin loci related to immune resistance.

---

quote:

---

After one mutation has occurred on a given chromosome, some generations will usually pass before another nearby mutation occurs, on a descendant chromosome carrying the first mutation. A fourth consequence of the modular nature of mutations in DNA is that they generate a cladistic, or hierarchically structured, pattern of sequences at the locus in a population. This produces a much stronger trace of gene history in the DNA sequences observed within and between populations. Throughout most of human history people have lived their entire lives within a few tens of kilometers of their birthplaces. Work several decades ago by Cavalli-Sforza and others showed a roughly exponential distribution of the distance between the birthplaces of parents and of their offspring (see Cavalli-Sforza et al., 1994). Alleles arising by mutation diffuse gradually from their place of origin if they survive, but most of them do not survive very long. Deleterious mutations are removed by selection, and due to drift, neutral mutations usually disappear in not very many generations.

---

posted 18. December 2003 05:43                    

code:

---

org1 TTATTATTATGTGAGTAACTGGAAGATACTGATAAGTTGACAAATCTTTTTCTTTCCTTTCTTATTCAACTTTTATTTTAGCTT

org2 ..............C...................T.........................G.......................  

org3 ..............C...................T.........................G.......................

org4 ..............C.............................................G.......................



  

---

code:

---

org1a TTATTATTATGTGAGTAACTGGAAGATACTGATAAGTTGACAAATCTTTTTCTTTCCTTTCTTATTCAACTTTTATTTTAGCTT

org1b ..............C.....................................................................  

org1c ..................................T.................................................

org1d ..............C.............................................G.......................



  
org1e ..............C.............................................A.......................  

org1f ............................................................G.......................

org1g ..................................T.........................G.......................

org1h ..............G...........................G..............C..........................

---

posted 20. December 2003 14:00                   

quote:

---

Most nucleotide variability observed in natural populations may be neutral, or nearly so [1]. Even so, natural selection can play an important role in shaping this variability through the effects of genetic linkage. In particular, neutral variants linked to a strongly favoured mutation can ‘hitchhike’ to fixation in the population, while other variants are lost [2]. More generally, because selection affects closely linked neutral variability, one can use the latter to draw inferences about the frequency and mode of adaptive evolution at genes of interest.

---

quote:

---

The observation that radiation accelerates point mutations at all is unexpected, at first glance, because radiation was, until recently, thought to generate primarily DNA lesions (1). A potential explanation is provided by our additional observation that these radiation-associated point mutations are also evolutionary hot spots, indicating that the radiation indirectly increases the cell's normal (evolutionary) mutation mechanism

Natural radioactivity and human mitochondrial DNA mutations Lucy Forster, Peter Forster, Sabine Lutz-Bonengel, Horst Willkomm, and Bernd Brinkmann

PNAS October 15, 2002 ,vol. 99, no. 21 pp 13950-13954

---

quote:

---

have arisen more than once during human evolution showed different properties from the remaining ones. The major continent-specific mtDNA lineages were analysed in terms of nucleotide diversity indices, neutrality tests and nonsynonymous/synonymous rate ratios, and patterns suggesting selective constraints possibly due to lineage-specific interactions were identified. Moreover, a general correlation between nucleotide position and nucleotide polymorphism was identified in the mtDNA. The results are compatible with the assumption that selection has a marked role in human mtDNA evolution and that selective constraints may vary between populations, so that the pathogenic potential of a given mutation may depend markedly on the presence of other, interacting mutations.

---

posted 25. December 2003 06:54                    

quote:

---

I ever denied the existance of NRM Peter, you should know this.

---

quote:

---

What you fail to provide is supporting evidence for your claims as to the effect of NRM on phylogeny. I have shown how NRM's do not affect phylogeny significantly.

---

quote:

---

So many errors. First of all NeoDarwinian theory is not atheistic, a common confusion though. Secondly Neo Darwinian evolution only stated that mutations were NON random wrt direct effect. Peter's NRM is to location or timing, which hardly are problematic to neo-darwinism.

---

quote:

---

So where is the evidence that NRM can cause common descent? So far nowhere as far as I can tell.

---

quote:

---

Scientific evidence supporting common descent is abundant in fossil data, molecular data from a large variety of sources.

---

quote:

---

In addition common descent is an inevitable outcome of variation, and heritable information.

---

quote:

---

In other words common descent follows from theoretical as well as empirical considerations.

---

quote:

---

Lacking any further evidence of common mechanism one has to reject Peter's suggestions. When Peter is able to propose similar theoretical and empirical foundations for his claims then we can do a comparison.

---

quote:

---

Compelling Data for Common Descent from Matching Redundant DNA Sequences

---

quote:

---

29+ Evidences for Macroevolution The Scientific Case for Common Descent

---

quote:

---

Perhaps Peter can provide us with a common mechanism which explains these data equally well or better.

---

quote:

---

In fact, I have shown how NRM does not affect the phylogenetic inferences so even in the presence of NRM, common descent seems to remain the viable explanation.

---

posted 25. December 2003 14:14                   

quote:

---

Sniegowski, P. D., and R. E. Lenski. 1995. Mutation and adaptation: the directed mutation controversy in evolutionary perspective. Annual Review of Ecology and Systematics 26:553-578.

Abstract:
A central tenet of evolutionary theory is that mutation is random with respect to its adaptive consequences for individual organisms; that is, the production of variation precedes and does not cause adaptation. Several recent experimental reports have challenged this tenet by suggesting that bacteria (and yeast) ''may have mechanisms for choosing which mutations will occur'' (6, p. 142). The phenomenon of nonrandom mutation claimed in these experiments was initially called ''directed mutation'' but has undergone several name changes during its brief and controversial history. The directed mutation hypothesis has not fared well; many examples of apparently directed mutation have been rejected in favor of more conventional explanations, and several reviews questioning the validity of directed mutation have appeared (53, 54, 59-61, 79, 80). Nonetheless, directed mutation has recently been reincarnated under the confusing label ''adaptive mutation'' (5, 23, 24, 27, 35, 74). Here we discuss the many experimental and conceptual problems with directed/adaptive mutation, and we argue that the most plausible molecular models proposed to explain ''adaptive mutation'' are entirely consistent with the modern Darwinian concept of adaptation by natural selection on randomly occurring variation. In the concluding section of the paper, we discuss the importance of an informed evolutionary approach in the study of the potential adaptive significance of mutational phenomena. Knowledge of the molecular bases of mutation is increasing rapidly, but rigorous evolutionary understanding lags behind. We note that ascribing adaptive significance to mutational phenomena (for example, ''adaptive mutation'') is beset with some of the same difficulties as ascribing adaptive significance to features of whole organisms (29). We consider some examples of mutational phenomena along with possible adaptive and nonadaptive explanations.

---

quote:

---

Many people think that questioning Darwinian evolution must be equivalent to espousing creationism. As commonly understood, creationism involves belief in an earth formed only about ten thousand years ago, an interpretation of the Bible that is still very popular. For the record, I have no reason to doubt that the universe is the billions of years old that physicists say it is. Further, I find the idea of common descent (that all organisms share a common ancestor) fairly convincing, and have no particular reason to doubt it. I greatly respect the work of my colleagues who study the development and behavior of organisms within an evolutionary framework, and I think that evolutinoary biologists have contributed enormously to our understanding of the world. Although Darwin's
mechanism--natural selection working on variation--might explain many things, however, I do not believe it explains molecular life. I also do not
think it surprising that the new science of the very small might change the way we view the less small." ~ Michael J. Behe, Darwin's Black Box, (New York: The Free Press, 1996), p. 7

---

quote:

---

A major assumption of many molecular phylogenetic methods is the homogeneity of nucleotide frequencies among taxa, which refers to the equality of the nucleotide frequency bias among species. Changes in nucleotide frequency among different lineages in a data set are thought to lead to erroneous phylogenetic inference because unrelated clades may appear similar because of evolutionarily unrelated similarities in nucleotide frequencies. We tested the effects of the heterogeneity of nucleotide frequency bias on phylogenetic inference, along with the interaction between this heterogeneity and stratified taxon sampling, by means of computer simulations using evolutionary parameters derived from genomic databases. We found that the phylogenetic trees inferred from data sets simulated under realistic, observed levels of heterogeneity for mammalian genes were reconstructed with accuracy comparable to those simulated with homogeneous nucleotide frequencies; the results hold for Neighbor-Joining, minimum evolution, maximum parsimony, and maximum-likelihood methods. The LogDet distance method, specifically designed to deal with heterogeneous nucleotide frequencies, does not perform better than distance methods that assume substitution pattern homogeneity among sequences. In these specific simulation conditions, we did not find a significant interaction between phylogenetic accuracy and substitution pattern heterogeneity among lineages, even when the taxon sampling is increased.

---

quote:

---

Significant transition/transversion mutation bias is a well-appreciated aspect of mammalian nuclear genomes; however, patterns of bias among genes within a genome and among species remain largely uncharacterized. Understanding these patterns is important for understanding similarities and differences in mutational patterns among genomes and genomic regions. Therefore, we have conducted an analysis of 7,587 pairs of sequences of 4,347 mammalian protein-coding genes from seven species (human, mouse, rat, cow, sheep, pig, and macaque) and from the introns of 51 gene pairs and multiple intergenic regions (37 kbp, 52 kbp and 65 kbp) from the human, chimpanzee, and baboon genomes. Our analyses show that genes and regions with widely varying base composition exhibit uniformity of transition mutation rate both within and among mammalian lineages, as long as the transitional mutations caused by CpG hypermutability are excluded. The estimates show no relationship to potential intrachromosomal or interchromosomal effects. This uniformity points to similarity in point mutation processes in genomic regions with substantially different GC-content biases.

---

quote:

---

Our results reveal that the observed heterogeneity
of nucleotide frequencies among mammalian lineages is likely to have little effect on the accuracy of the reconstructed phylogeny. These results were consistent for all methods examined, regardless of overall accuracy. This is not to say that heterogeneity will never cause errors; these errors are simply probably not as common as
previously suggested, and other potential problems should be explored in more depth. Although the present results show that heterogeneity of nucleotide frequencies may not
be as important a factor in phylogenetic analysis as often believed, accounting for heterogeneity is still an important aspect of many other evolutionary analyses, e.g., in the determination of substitution rates (Tourasse and Li 1999;
Kumar and Subramanian 2002; Tamura and Kumar 2002).

---

posted 26. December 2003 13:01                   

quote:

---

We describe a new zinc finger gene sequence (CMPX1 or HGM symbol ZNF6; isolated by cross-hybridization of ZFY to clones in a testis cDNA library) which possesses a zinc finger domain closely related to the transcriptional activator gene ZFX. The putative acidic activation domain is only 11.5% homologous with ZFX, whereas the putative DNA binding domain shares 75% homology and shows the same organisation composed of a basic two fingered repeat unit. ZNF6 has an unusually large 5' untranslated region (UTR) of 1.2 Kb which contains 26 potential ATG initiation codons, only one of which is associated with a long open reading frame. Southern and Northern blot analysis has shown that this 5' UTR is shared with many other sequences in the genome and transcribed associated with a large range of mRNA species. In situ hybridisation, analysis of somatic cell hybrids and male individuals carrying deleted X chromosomes have mapped the gene to Xq21.1-q21.3. The gene is highly conserved amongst the primates, in the mouse and can be detected weakly in the genome of a metatherian mammal (possum). Dosage in male and female mice indicates that it is also X-linked in this species. Possible origins of ZFX, ZFY and CMPX1 from a common ancestral gene are discussed

---

quote:

---

Mol Biol Evol 2000 May;17(5):804-12 Related Articles, Links

Sex chromosomal transposable element accumulation and male-driven substitutional evolution in humans.

Erlandsson R, Wilson JF, Paabo S.

Max-Planck-Institute for Evolutionary Anthropology, Leipzig, Germany. riker1@biochem.kth.se

We sequenced the genomic region containing the human Y-linked zinc finger gene (ZFY). Comparison of ZFY to the related region on the X chromosome (ZFX) and to autosomal sequences reveals a significant accumulation of transposable elements on the sex chromosomes. In addition, five times as many retroviruslike elements (RLEs) are present in the ZFY region as in the ZFX region. Thus, transposable elements accumulate more rapidly on the sex chromosomes, and the insertion of RLEs may occur more frequently in the male than in the female germ line. When the accumulation of substitutions in Alu elements was analyzed, it was found that the Alu elements at the Y-chromosomal locus diverged significantly faster than those at the X-chromosomal locus, whereas the divergence of autosomal Alu elements was intermediate. The male-to-female mutation rate ratio was estimated to be 2.5.

---

quote:

---

Evolution of the X-linked Zinc Finger Gene and the Y-linked Zinc Finger Gene in Primates
Heui-Soo Kim (1) (*), Osamu Takenaka (2)

We have sequenced the partial exon of the zinc finger genes (ZFX and ZFY) in 5 hominoids, 2 Old World monkeys, 1 New World monkey, and 1 prosimian. Among these primate species, the percentage similarities of the nucleotide sequence of the ZFX gene were 96-100% and 91.2-99.7% for the ZFY gene. Of 397 sites in the ZFX and ZFY gene sequences, 20 for ZFX gene and 42 for ZFY gene were found to be variable. Substitution causes 1 amino acid change in ZFX, and 5 in ZFY, among 132 amino acids. The numbers of synonymous substitutions per site (Ks) between human and the chimpanzee, gorilla and orangutan for ZFY gene were 0.026, 0.033, and 0.085, respectively. In contrast, the Ks value between human and hominoid primates for the ZFX gene was 0.008 for each comparison. Comparison of the ZFX and ZFY genes revealed that the synonymous substitution levels were higher in hominoids than in other primates. The rates of synonymous substitution per site per year were higher in the ZFY exon than in the SRY exon, and higher in the ZFY exon than in the ZFY intron, in hominoid primates.

---

quote:

---

ABSTRACT
With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions(inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide
distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

---

quote:

---

Global hypermutation in a subpopulation The data above do not address the controversial possibility that mutations might be directed preferentially to those genes that could favour survival in the selective environment7. This question was answered in the lac frameshift system by the discovery that mutations are not directed to58,76, or even to the same DNA molecule as58, the lac gene, which supports a random Darwinian process of mutation.

---

quote:

---

These results mean, first, that stationary-phase mutations in this system are not directed to the lac gene — both adaptive and neutral mutations are formed.

---