|
Author
|
Topic: Wells' Molecular Phylogenies
|
Ron Okimoto
Member
Member # 1012
|
posted 16. December 2003 08:56
Peter:
Whoever told you that the nesting is only found in closely related species lied to you. The nesting is found among all lifeforms to some degree. Early at the base it seems to be scrambled by horizontal transfer of genetic material amoung those early lifeforms, but we do not have this problem in the vertebrate lineage. You have to get the nesting to work not just for closely related species, but for basically all vertebrates, all metazoans and all eukaryotes.
You can't even get it to work for the ape lineage. Why do we see the nesting that we see among the apes? Why isn't it just a random pattern of NRM fixation in each lineage? Why do the apes nest within monkeys and monkeys within primates? You have to come up with a way that the NRMs were fixed in just the pattern that would be needed to infer common descent and not some random pattern.
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 16. December 2003 23:35
Peter: In other words, the author says that either it has a common origin through common descent or through common mechanism (=NRM). Next he says that it may be "extremely unlikely" that multiple parallel mutations occur. It should be noted, however, that it is only extremely unlikely under his evolutionary (outdated) assumption that mutations are introduced at random only.
Lacking any evidence to support his claims Peter seems to jump to conclusions but no effort really to explain his claims about NRM and common descent or how NRM would lead to appearance of common descent.
Perhaps if Peter could explain in more detail how he intends to deal with polymorphism as relevant to his claims?
Peter: As I have demonstrated in several organisms now, mutations are not random, and commonly the same locations are involved. As a matter of fact I can substantiate that for almost all discussed sequences.
No you have not done this. What you have shown is evidence of polymorphism which is quite different from NRM.
Peter: A close look at his model demonstrates that it assumes randomness and neutrality of mutations.
Any details and any evidence that these assumptions which seem to quite well explain the observations are erroneous? Any evidence of NRM in the sense used by Peter?
In the end these are just one of the many details for which an explanation seems to be lacking. What really matters is that Peter so far has made assertions but not provided for any coherent argument to support his claims about NRM and common descent.
Peter: , the long lived polymorphism suppose to have been maintained by natural selection (page 7730). Neutral selection? Neutral selection is nothing but an oxymoron
Did you read the paper? Do you understand that the argument is not that they were maintained by neutral selection? It is easy to jump to conclusions which are totally irrelevant when one does not take time to read the paper.
Peter: So, still you cannot discriminate between a common mechanism or common descent.
Since Peter has yet to show any evidence of such a common mechanism other than by saying look common descent, must have been a common mechanism. What mechanism? Well one which gives the appearance of common descent. Any details?... So far none.
The paper which I referenced (Clark 1997) lays a theoretical foundation to polymorphisms. That's far more than I have seen from Peter wrt NRM
From the paper
quote:
ABSTRACT Several cases have been described in the literature where genetic polymorphism appears to be shared between a pair of species.
More details quote:
Shared polymorphism may be formally defined as follows: suppose species A has two alleles at a locus, A1 and A2, and species B also has two alleles at the homologous locus, labeled B1 and B2. Shared polymorphism occurs if alleles A1 and B1 cluster together and are significantly divergent from alleles A2 and B2, which also cluster together. The biological conclusions to be drawn from shared polymorphism depend on the chance that neutral alleles can exhibit this property. Formally, shared polymorphism may arise either when there was a polymorphism in the population ancestral to the two species examined today, and that polymorphism has been maintained through the two distinct species’ lineages, or by more recent parallel generation of similar alleles. If the identity of alleles is well described, as is the case for DNA sequences, it may be extremely unlikely that multiple parallel mutations had occurred.
Now about polymorphism
quote:
Fig. 4 illustrates one way to conceptualize the problem of shared polymorphism in the context of the coalescent. If two species each coalesce to a common ancestral allele more recently than the time at which they share a common ancestor, then there is not shared polymorphism (Fig. 4A). On the other hand, if they do not have this recent coalescence event, then they share polymorphism (Fig. 4B).
The selective bottleneck sweep provides for the actual data. Their table 3 performs the neutrality tests. Selective sweep may be something Peter objects to but so far these explanations seem to be far better supported in both theoretical foundation and empirical data.
But lets not get side tracked by these issues. Why does Peter not show us how NRM can generate apparant common descent, nested hierarchies etc.
Until Peter can propose a 'common mechanism' and shows that it can explain the data better, I would have to conclude that Peter's conclusions may be a bit premature. [ 16. December 2003, 23:42: Message edited by: Pim van Meurs ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 17. December 2003 10:32
Talking about "jumping to conclusions". Lacking any evidence to support NDT the usual evo gibberish is propagated everywhere, anywhere and anytime. As long as you cannot discriminate between a common mechanism and common descent evolutinary theory is jumping the gun. Not me. I provided an alternative that is in many cases explanantory where evolutionary theory is not. Apparently, an alternative is not allowed.
you have already demonstrated to be deliberately obtuse, and now you do it again. In GUToB I have addressed NRM and they can simply be conceived as point mutations (polymorphisms) that are observed on the same spot independent of common descent. That is the GUToB explanation for the alignment of shared mutations. You know that and I repeat it as many times as you like.
Peter: As I have demonstrated in several organisms now, mutations are not random, and commonly the same locations are involved. As a matter of fact I can substantiate that for almost all discussed sequences.
What I have shown is evidence that independent of common descent polymorphism may line up to give the impression of common descent. The good part from such polymorphisms is that they confirm NRM2, a prediction of GUToB. I have shown them in drosophila, human, and HERVs. Now the denial is from the evolutionary community. And it was to be expected. I went through this discussion before, and fortunately this is not a proevolutionary site, otherwise I would have been suspended a long time ago.
Peter: A close look at his model demonstrates that it assumes randomness and neutrality of mutations.
Pim: Any details and any evidence that these assumptions which seem to quite well explain the observations are erroneous? Any evidence of NRM in the sense used by Peter?
It is an evolutionist's assumption and nothing but that. The data can also be explained in exacly the same way if a common mechanism is involved. I still wait for you provide a tool to discriminate between common mechanism and common descent.
Peter: , the long lived polymorphism suppose to have been maintained by natural selection (page 7730). Neutral selection? Neutral selection is nothing but an oxymoron
Then you ask me whether I did you read the paper? And whether I understand that the argument is not that they were maintained by neutral selection? Yep, I read that paper in the bus when I returend home a couple of days ago and you have had my comments...
...and I have shown you the evidence of NRM and a possible mechanism in T4 (the imperfect hairpin) But there must be additional mechanism otherwise we cannot explain why the point mutations in an integrated DNA element are almost always on the same spot (as discussed in GUToB), and different from when the same element is not integrated.
You are free to deny that such mecahnism exists, I do not mind. But do not tell me that you are following a scientific approach, since denial is not part of it.
Next you say that "The paper which I referenced (Clark 1997) lays a theoretical foundation to polymorphisms. That's far more than I have seen from Peter wrt NRM
Apparently you did not understand Clarks paper. It is to get data that would advocate NRM in accord with standard evolutionary theory. That is what it is about: Explaining data away. The data are however in accord with GUToB (and NRM), not NDT. Have a nice day,
pb
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 17. December 2003 12:26
Peter still seems to be unable to provide for a common mechanism that explains the data equally well or better. Without any details his ideas have to be rejected due to lack of scientific content.
I showed a good example of how such may be attempted, Clark and others, rather than explaining away the data with, must have been a common mechanism, they worked on a theoretical foundation and found supportive data for their assumptions.
That is how a scientific hypothesis is developed. Peter's ideas about common mechanism are interesting but lacking in both theoretical foundation and empirical support, especially to the extent that such common mechanisms would give rise to common descent. Until Peter explains how NRM may give the impression of common descent, or provides for the necessary foundations, we will have to reject his claims.
Common descent is the expected outcome of inheritable material and variations and selection. Variations and selection are both observed in nature.
Perhaps Peter can explain how NRs can give the false appearance of common descent? I have shown that NRMs in phylogenetic studies did NOT impact the findings.
Peter: Not me. I provided an alternative that is in many cases explanantory where evolutionary theory is not. Apparently, an alternative is not allowed.
I have shown that evolutionary theory is far more explanatory in many of this instances and contrary to Peter's suggestions that an alternative is not allowed, I have invited Peter to explain how his common mechanisms can give rise to (false) common descent.
Another interesting paper
Is There a Paradigm Shift in Genetics? Lessons from the Study of Human Diseases KENNETH M. WEISS MOLECULAR PHYLOGENETICS AND EVOLUTION Vol. 5, No. 1, February, pp. 259–265, 1996
quote:
This clearly occurred with acceptance of the basic idea of evolution, that the distribution and resemblances among species are due to their pattern of shared ancestry. This explained so many things naturally, rather than by contorted arguments, that we all now quote Dobzhansky’s dictum that ‘‘nothing in biology makes sense except in the light of evolution.’’ Continental drift, the Copernican astronomy, relativity, spherical geometry, and the atomic model of matter are other examples of transforming paradigm shifts.
Now about multiple alleles
quote:
A second major consequence of the modular nature of DNA and random location of mutations is that there should be many, not two, alleles at any locus. Multiple alleles were of course formally consistent with population genetics theory, but were given little importance in the prevailing adaptionist perspective, except in some easily explicable special cases such as selection for high variation per se in the HLA and immunoglobulin loci related to immune resistance.
Perhaps Peter can explain the data in terms of NRM?
The paper again
quote:
After one mutation has occurred on a given chromosome, some generations will usually pass before another nearby mutation occurs, on a descendant chromosome carrying the first mutation. A fourth consequence of the modular nature of mutations in DNA is that they generate a cladistic, or hierarchically structured, pattern of sequences at the locus in a population. This produces a much stronger trace of gene history in the DNA sequences observed within and between populations. Throughout most of human history people have lived their entire lives within a few tens of kilometers of their birthplaces. Work several decades ago by Cavalli-Sforza and others showed a roughly exponential distribution of the distance between the birthplaces of parents and of their offspring (see Cavalli-Sforza et al., 1994). Alleles arising by mutation diffuse gradually from their place of origin if they survive, but most of them do not survive very long. Deleterious mutations are removed by selection, and due to drift, neutral mutations usually disappear in not very many generations.
Finally lets make it clear that I accept NRM. In fact I would say that Darwinian and Neo-Darwinian theory has little problem accepting that mutations can be non-random wrt location, time etc. NRM by themselves are not the issue as much as the common mechanisms that give rise to appearance of common descent. Until Peter can show that common descent is an illusion due to a 'common mechanism', his claims to the contrary seem premature. [ 17. December 2003, 12:58: Message edited by: Pim van Meurs ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 18. December 2003 05:43
Pim: Peter still seems to be unable to provide for a common mechanism that explains the data equally well or better. Without any details his ideas have to be rejected due to lack of scientific content.
The mechanisms to introduce NRM thus far described in scientific literature: 1) imperfect hairpin, 2) protein mediated editing of DNA, 3) high levels of radioactive background. All discussed in the GUToB thread.
Pim: I showed a good example of how such may be attempted, Clark and others, rather than explaining away the data with, must have been a common mechanism, they worked on a theoretical foundation and found supportive data for their assumptions.
Math is not biology (although some biological principles can be described by math). Math is a tautology: what you define is what you find. The Clark paper was based on Kimura`s neutral theory. What do you require a neutral theory for when evolution is supposed to be driven through selection?
Pim: Peter's ideas about common mechanism are interesting but lacking in both theoretical foundation and empirical support, especially to the extent that such common mechanisms would give rise to common descent. Until Peter explains how NRM may give the impression of common descent, or provides for the necessary foundations, we will have to reject his claims.
This statement is simply not true. I have given several examples of NRM and how they line up. Moreover, I have stressed the fact that similar MPG (like the big apes) may have similar mechanisms. I have demonstrated this with the globin pseudogene in primates where one can easily detect the MPGs. It only required another stance.
Pim: Common descent is the expected outcome of inheritable material and variations and selection. Variations and selection are both observed in nature.
This is also untrue. Although variation and selection are not disputed in GUToB, the terms have nothing in common with common descent. Variation may be non random plus random (as mentioned) and the NRM may give the illusion of common descent. For instance:
code:
org1 TTATTATTATGTGAGTAACTGGAAGATACTGATAAGTTGACAAATCTTTTTCTTTCCTTTCTTATTCAACTTTTATTTTAGCTT
org2 ..............C...................T.........................G.......................
org3 ..............C...................T.........................G.......................
org4 ..............C.............................................G.......................
At first glance the above sequences give a nice impression of common descent. But you do not know anything about the NRM in this sequences since it pertains only one sequence per organism. And according to the new genetic paradigm many polymorphisms are present per genetic element (alleles). Since you cannot exclude the presence of NRM in the sequences you cannot say anything about common descent. The presence of NRM will only become visible after comparing several sequences from organism 1, several from organism 2, organsim 3, and organsim 4. So what you could get for 8 organisms of the same species (1a-1h) is:
code:
org1a TTATTATTATGTGAGTAACTGGAAGATACTGATAAGTTGACAAATCTTTTTCTTTCCTTTCTTATTCAACTTTTATTTTAGCTT
org1b ..............C.....................................................................
org1c ..................................T.................................................
org1d ..............C.............................................G.......................
org1e ..............C.............................................A.......................
org1f ............................................................G.......................
org1g ..................................T.........................G.......................
org1h ..............G...........................G..............C..........................
It is clear that NRM are present in this stretch of DNA which become only obvious when you study several of the same sequences within one species. You cannot just get one sequence, compare it with other species and say that the shared mutations are due to common descent. That is not science, since you have to know something about the nature of the mutations. If you are able to exclude a NR nature of the mutations that are shared between species than there is a possibility of common descent, but still it could be common origin, not descent. In other words, you can not be sure about common descent as long as you do not have a "mean sequence" indicating all NRM positions and quasi NRM positions. The above example is pretty close to what we observe in human mtDNA: i.e. NRM, independent of common descent (as discussed in GUToB).
And than Pim claims that he has "shown that evolutionary theory is far more explanatory in many of this instances and contrary to Peter's suggestions that an alternative is not allowed, I have invited Peter to explain how his common mechanisms can give rise to (false) common descent."
AS explained above (again, I will explain it as many times as you like), common descent or common mechanisms may underly the shared mutations. Still, you did not provide a tool to discriminate between the two. I, on the contrary, keep explaining and providing evidence for my stance. pb [ 18. December 2003, 06:14: Message edited by: peter borger ]
IP: Logged
|
|
Ron Okimoto
Member
Member # 1012
|
posted 18. December 2003 08:26
Peter:
You should try and do this with a real data set. Real data has the transition to transversion ratio at 2:1. Transitions are pyrimidine to pyrimidine and purine to purine. Nearly all your data are transversions purine to pyrimidine. For species this closely related transistions should outnumber transversions. I do not know of a hotspot of mutation that mutates more transversions than transitions.
What you will find is that NRMs only make the organisms more closely related than they might be. They also can have the opposite effect if they are changing rapidly they often change back. You get a more accurate estimate of mutation rates at those sites, but it gives you an over estimate of what is observed longterm. This is the problem that they are seeing in the human mitochondrial data. It is one of the big reasons why the estimate since "mitochondrial" eve keeps dropping.
Why don't you try and make your NRM idea work on some real data?
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 20. December 2003 14:00
Peter still has not addressed my question namely that he provides a common mechanism and explains how such a mechanisms can give the appearance of common descent including nested hierarchies.
Peter: What do you require a neutral theory for when evolution is supposed to be driven through selection?
Because evolution is not supposed to be solely driven by selection. Neutral mutations are an essential contributor to evolvability, robustness and form an important source of variation for selection to work on at a later time.
I can provide you some good papers that describe this context.
But lets get back to my comment which was that Clark and others provided for a theoretical foundation for their claims. Until Peter can explain in sufficient detail nested hierarchies and common descent patterns using NRMs, common descent seems to be the most logical and best supported explanation for the available data. Not surprisingly because common descent is such a prevalent observation in nature. In fact I have shown how NRM do not seem to affect the common descent interpretation much in actual experiments.
So once again, Peter has failed to show that his examples are non random mutations, in fact I have shown how science explains these observations in a much better manner.
I will have to wait until Peter presents his ideas in sufficient detail. And to guide the direction, I will restate that I do accept non random mutations, in fact randomness as used in evolutionary theory refers only to immediate effect on fitness, not to location, time or even mechanism. The question is: can such non random mutations give a consistent impression of nested hierarchies leading to an appearance of common descent? Peter claims it can but has not provided the analysis necessary to reach this conclusion. We also have to be careful not to confound NRM with selection which can give the appearance of non random mutation. Or for instance the selective sweep in polymorphisms
"Patterns of DNA sequence polymorphism at Sod vicinities in Drosophila melanogaster: Unraveling the footprint of a recent selective sweep" Alberto Saez, Andrey Tatarenkov, Eladio Barrio, Nelsson Becerra†, and Francisco J. Ayala PNAS February 18, 2003 vol. 100 no. 4 1793–1798
This paper shows an example of genetic hitchhiking and selective sweep.
another interesting paper "Adaptive hitchhiking effects on genome variability" by Peter Andolfatto Current Opinion in Genetics & Development 2001, 11:635–641
quote:
Most nucleotide variability observed in natural populations may be neutral, or nearly so [1]. Even so, natural selection can play an important role in shaping this variability through the effects of genetic linkage. In particular, neutral variants linked to a strongly favoured mutation can ‘hitchhike’ to fixation in the population, while other variants are lost [2]. More generally, because selection affects closely linked neutral variability, one can use the latter to draw inferences about the frequency and mode of adaptive evolution at genes of interest.
Seems that science has uncovered many 'common mechanisms' but so far none seem to undermine common descent in any serious manner.
Peter mentions radioactivity as an example of a mechanism for NRM but is this really NRM and how would this affect common descent?
quote:
The observation that radiation accelerates point mutations at all is unexpected, at first glance, because radiation was, until recently, thought to generate primarily DNA lesions (1). A potential explanation is provided by our additional observation that these radiation-associated point mutations are also evolutionary hot spots, indicating that the radiation indirectly increases the cell's normal (evolutionary) mutation mechanism
Natural radioactivity and human mitochondrial DNA mutations Lucy Forster, Peter Forster, Sabine Lutz-Bonengel, Horst Willkomm, and Bernd Brinkmann
PNAS October 15, 2002 ,vol. 99, no. 21 pp 13950-13954
they conclude "autosomal minisatellites. As demonstrated, our mtDNA results strongly support an acceleration of the evolutionary DNA mutation mechanism through radiation."
There is an interesting thesis on mtDNA
quote:
have arisen more than once during human evolution showed different properties from the remaining ones. The major continent-specific mtDNA lineages were analysed in terms of nucleotide diversity indices, neutrality tests and nonsynonymous/synonymous rate ratios, and patterns suggesting selective constraints possibly due to lineage-specific interactions were identified. Moreover, a general correlation between nucleotide position and nucleotide polymorphism was identified in the mtDNA. The results are compatible with the assumption that selection has a marked role in human mtDNA evolution and that selective constraints may vary between populations, so that the pathogenic potential of a given mutation may depend markedly on the presence of other, interacting mutations.
JUKKA MOILANEN NON-NEUTRAL SEQUENCE VARIATION IN HUMAN MITOCHONDRIAL DNA: SELECTION AGAINST DELETERIOUS MUTATIONS AND HAPLOGROUPRELATED POLYMORPHISMS [ 20. December 2003, 15:08: Message edited by: Pim van Meurs ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 24. December 2003 16:35
It is good to see that you are starting to acknowledge NRM. Their impact on phylogeny can easily be understood from a couple of human mtDNA regions. It has been known for quite a while that the mtDNA is subject to NRM but its impact has not yet been acknowledged. Let have a look here:
Soodyall H, et al. mtDNA control-region sequence variation suggests multiple independent origins of an "Asian-specific" 9-bp deletion in sub-Saharan Africans. Am J Hum Genet. 1996, 58:595-608.
From these and other data:
Horai S, et al. mtDNA polymorphism in East asian population, with specific reference to the peopling of Japan. Am J Hum Genet. 1996, 59:579-90.
Surprisingly, sequencing the major noncoding (D-loop) of human mtDNA we find that the same 9-bp deletion is present in both Asian and African populations INDEPENDENT of common descent, and therefore they group together independent of common descent. In other words, these populations of organisms demonstrate nested mutations (deletions). So, nested mutations are not at all evidence of common descent. If they proof anything than it is common mechanisms underlying shared mutations. As you see, NRM are present everywhere and NRM bring down the most convincing molecular argument of common descent, since the observed shared mutations line up and give a false impression of common descent.
It is allowed, however, to extrapolate the above data to more distantly related MPGs (such as human and chimp), since it is backed up by state of the art science (as referred to). Human and chimp DNA may also have shared mutations independent of common descent. That should not be hard to understand from the above data. Once acknowledged, it brings down the best argument of common descent, and therefore the best argument for evolutionary theory.
In my opinion, you cannot provide equally hard, indisputable, scientific data to back up common descent that cannot be equally well explained by common mechanims. But show otherwise and convince me if I am wrong.
As we know now the neodarwian atheist's theory of evolution is completely unwarranted, since it was based on not understood NRM (it was set up in the 1940s, DNA was not even described. The NDTers argued from ignorance). This can be deduced from both visible evolutionary observatons (pigeons, drosophila, human) and recent molecular phenomena (any sequence). Darwin even described NRM in his 19th century best seller "The Origin".
BTW, selection against is GUToB.
pb [ 24. December 2003, 16:47: Message edited by: peter borger ]
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 24. December 2003 20:34
Peter: It is good to see that you are starting to acknowledge NRM. Their impact on phylogeny can easily be understood from a couple of human mtDNA regions. It has been known for quite a while that the mtDNA is subject to NRM but its impact has not yet been acknowledged. Let have a look here:
I ever denied the existance of NRM Peter, you should know this. What you fail to provide is supporting evidence for your claims as to the effect of NRM on phylogeny. I have shown how NRM's do not affect phylogeny significantly.
Peter: As we know now the neodarwian atheist's theory of evolution is completely unwarranted, since it was based on not understood NRM
So many errors. First of all NeoDarwinian theory is not atheistic, a common confusion though. Secondly Neo Darwinian evolution only stated that mutations were NON random wrt direct effect. Peter's NRM is to location or timing, which hardly are problematic to neo-darwinism.
So where is the evidence that NRM can cause common descent? So far nowhere as far as I can tell.
Peter: In my opinion, you cannot provide equally hard, indisputable, scientific data to back up common descent that cannot be equally well explained by common mechanims. But show otherwise and convince me if I am wrong.
Scientific evidence supporting common descent is abundant in fossil data, molecular data from a large variety of sources. In addition common descent is an inevitable outcome of variation, and heritable information. In other words common descent follows from theoretical as well as empirical considerations. Lacking any further evidence of common mechanism one has to reject Peter's suggestions. When Peter is able to propose similar theoretical and empirical foundations for his claims then we can do a comparison.
Compelling Data for Common Descent from Matching Redundant DNA Sequences
29+ Evidences for Macroevolution The Scientific Case for Common Descent
Perhaps Peter can provide us with a common mechanism which explains these data equally well or better.
In fact I have shown how NRM does not affect the phylogenetic inferences so even in the presence of NRM, common descent seems to remain the viable explanation. [ 24. December 2003, 22:37: Message edited by: Pim van Meurs ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 25. December 2003 06:54
quote: I ever denied the existance of NRM Peter, you should know this.
Yes, I know and it is good to see you change.
quote: What you fail to provide is supporting evidence for your claims as to the effect of NRM on phylogeny. I have shown how NRM's do not affect phylogeny significantly.
I did, and my latest post also did. Examples like this demonstrate that NRM in disctinct organisms group together and give the impression of common descent. I have proofed this beyond any doubt. See all my examples.
quote: So many errors. First of all NeoDarwinian theory is not atheistic, a common confusion though. Secondly Neo Darwinian evolution only stated that mutations were NON random wrt direct effect. Peter's NRM is to location or timing, which hardly are problematic to neo-darwinism.
Okay. I know that NDT's randomness is with respect to effect. But even that concept has been shown wrong. Adaptive mutations demonstrate that errorprone DNA polymerases are induced in microorganisms upon stress situations (and thus as a response to the environment) that directly modulate DNA regions, in such way that adaptive phenotypes arise. That demonstrates NDT to be invalid. And lets forget about the atheism of NDTers. That will be denied all the time, any time. quote: So where is the evidence that NRM can cause common descent? So far nowhere as far as I can tell.
No, you do not yet get it. NRM does not cause common descent. NRM generate the impression of common descent. So, what evo's take as molecular evidence of common descent can as well be explained by NRM. You still did not provide a tool to discriminate between common mechanisms that induce NRM and common descent. So, common descent is conclusion jumping.
quote: Scientific evidence supporting common descent is abundant in fossil data, molecular data from a large variety of sources.
No, it is not. The fossil record does not show common descent. All you can say is that is probably shows a common origin. And the molecular data to demonstrate common descent are in dispute here. At least that is what I thought this discussion is about: NRM may give the impression of common descent. You cannot take something that is in dispute as evidence for your stance.
quote: In addition common descent is an inevitable outcome of variation, and heritable information.
Your arguments are all "non sequiturs". Common descent does not follow logically from variation and heritable information. I mis reproducton in your story. Only organism that are linked to each other through reproduction can aslo be linked through common descent. Most organisms do not reproduce with each other. So, common descent is highly disputable from this stance too.
quote: In other words common descent follows from theoretical as well as empirical considerations.
No, Pim, as shown above common descent does not follow from these disciplines. The theoretical models assume that organisms repoduce, and they apriori assume that there is Darwinian evolution (variation plus selection). It could be a common mechanism, though.
quote: Lacking any further evidence of common mechanism one has to reject Peter's suggestions. When Peter is able to propose similar theoretical and empirical foundations for his claims then we can do a comparison.
The more scientific evidence I present for NRM the harder you deny it. What debating tactics are these?
quote: Compelling Data for Common Descent from Matching Redundant DNA Sequences
This pertains a website and can not be considered scientific. Anyway, who decided the sequences are redundant? The sequences compared are probably not redundant, since real redundant sequences vary between chimp and human by approx 50%, and probably these sequences are not even redundant, but involved in specifying organisms. Here, redundancy is an argument from ignorance. In addition, I have already shown in the GUToB thread that genetic redundancies are not associated with gene duplication and that they do not change faster than essential (non redundant) genes. Also quite compelling for evolutionary theory to be wrong.
quote: 29+ Evidences for Macroevolution The Scientific Case for Common Descent
This also pertains a web site. All molecular data shown here can be explained according the NRM hypothesis equally well or better. I do not see a problem here.
quote: Perhaps Peter can provide us with a common mechanism which explains these data equally well or better.
I gave you three mechanism, already. Did it ever occur to you that there may be more than these three, but that they are still undiscovered? In my field finding and describing one mechanism involved in regulation of a particular gene is usually sufficient for a scientific publication. I find three mechanisms quite compelling. quote: In fact, I have shown how NRM does not affect the phylogenetic inferences so even in the presence of NRM, common descent seems to remain the viable explanation.
No, you did not. You showed how a well known hot spot does not affect phylogenetic inferences. In return I said, most spots involved in phylogenetic inferences are NRM. And I provided a tool how to find them. Importantly, GUToB says that NRM does not only affect phylogenetic inferences, it CAUSES the phylogeny. The more similar a sequence is the more likely it is that mutations are introduced on the same spots in such sequences. I gave you the references for that ages ago. So, I am on solid ground with my thesis that NRM may give the impression of common descent. pb
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 25. December 2003 14:14
Pim: I (n)ever denied the existance of NRM Peter, you should know this.
Peter: Yes, I know and it is good to see you change.
How come that Peter has to suggest that I changed when in fact this has been my position from the start?
Pim: What you fail to provide is supporting evidence for your claims as to the effect of NRM on phylogeny. I have shown how NRM's do not affect phylogeny significantly.
Peter: I did, and my latest post also did. Examples like this demonstrate that NRM in disctinct organisms group together and give the impression of common descent.
You have made the CLAIM that this is what happens but you have failed to give any in depth analysis.
Peter: I have proofed this beyond any doubt. See all my examples.
You have asserted this beyond any doubt. Perhaps you are confused as to the meaning of proof especially in a scientific context.
Pim: So many errors. First of all NeoDarwinian theory is not atheistic, a common confusion though. Secondly Neo Darwinian evolution only stated that mutations were NON random wrt direct effect. Peter's NRM is to location or timing, which hardly are problematic to neo-darwinism.
Peter: Okay. I know that NDT's randomness is with respect to effect. But even that concept has been shown wrong. Adaptive mutations demonstrate that errorprone DNA polymerases are induced in microorganisms upon stress situations (and thus as a response to the environment) that directly modulate DNA regions, in such way that adaptive phenotypes arise. That demonstrates NDT to be invalid.
Why? In fact the response is an increase random mutation rate on which selection has to work. Sounds quite Darwinian to me. See for instance
quote:
Sniegowski, P. D., and R. E. Lenski. 1995. Mutation and adaptation: the directed mutation controversy in evolutionary perspective. Annual Review of Ecology and Systematics 26:553-578.
Abstract: A central tenet of evolutionary theory is that mutation is random with respect to its adaptive consequences for individual organisms; that is, the production of variation precedes and does not cause adaptation. Several recent experimental reports have challenged this tenet by suggesting that bacteria (and yeast) ''may have mechanisms for choosing which mutations will occur'' (6, p. 142). The phenomenon of nonrandom mutation claimed in these experiments was initially called ''directed mutation'' but has undergone several name changes during its brief and controversial history. The directed mutation hypothesis has not fared well; many examples of apparently directed mutation have been rejected in favor of more conventional explanations, and several reviews questioning the validity of directed mutation have appeared (53, 54, 59-61, 79, 80). Nonetheless, directed mutation has recently been reincarnated under the confusing label ''adaptive mutation'' (5, 23, 24, 27, 35, 74). Here we discuss the many experimental and conceptual problems with directed/adaptive mutation, and we argue that the most plausible molecular models proposed to explain ''adaptive mutation'' are entirely consistent with the modern Darwinian concept of adaptation by natural selection on randomly occurring variation. In the concluding section of the paper, we discuss the importance of an informed evolutionary approach in the study of the potential adaptive significance of mutational phenomena. Knowledge of the molecular bases of mutation is increasing rapidly, but rigorous evolutionary understanding lags behind. We note that ascribing adaptive significance to mutational phenomena (for example, ''adaptive mutation'') is beset with some of the same difficulties as ascribing adaptive significance to features of whole organisms (29). We consider some examples of mutational phenomena along with possible adaptive and nonadaptive explanations.
Peter: And lets forget about the atheism of NDTers. That will be denied all the time, any time.
Seems Peter was confusing the atheism of NDT proponents with NDT being an atheistic theory. A common confusion indeed. So lets forget about this lest Peter wants to continue his non sequitur.
Pim: So where is the evidence that NRM can cause common descent? So far nowhere as far as I can tell.
Peter: No, you do not yet get it. NRM does not cause common descent. NRM generate the impression of common descent.
That's what I meant and you have yet to show this.
Peter: So, what evo's take as molecular evidence of common descent can as well be explained by NRM.
Begging the question. Lacking any coherent theory this may or may not be the case. I have provided Peter with the links to 29 evidences of macro evolution. Could Peter venture to show that NRM explains this data?
Pim: Scientific evidence supporting common descent is abundant in fossil data, molecular data from a large variety of sources.
Peter: No, it is not. The fossil record does not show common descent.
Again a comment based on unfamiliarity with the data.
Peter: All you can say is that is probably shows a common origin. And the molecular data to demonstrate common descent are in dispute here.
It's the fact that the two independent evidences support each other which make common descent such a likely explanation.
Peter: At least that is what I thought this discussion is about: NRM may give the impression of common descent. You cannot take something that is in dispute as evidence for your stance.
Thus I used the fact that there is more than molecular data to show common descent. All the various lines of data support and strengthen the fact of common descent.
Pim: In addition common descent is an inevitable outcome of variation, and heritable information.
Peter: Your arguments are all "non sequiturs". Common descent does not follow logically from variation and heritable information.
It surely does, just build your own family tree for instance.
Peter: I mis reproducton in your story. Only organism that are linked to each other through reproduction can aslo be linked through common descent.
What part of heritable information confuses you?
Peter: Most organisms do not reproduce with each other. So, common descent is highly disputable from this stance too.
Why is Peter confusing sexual and non-sexual reproduction?
Pim: In other words common descent follows from theoretical as well as empirical considerations.
Peter: No, Pim, as shown above common descent does not follow from these disciplines. The theoretical models assume that organisms repoduce, and they apriori assume that there is Darwinian evolution (variation plus selection). It could be a common mechanism, though.
Sure it could but you have failed to show any evidence that such a mechanism would give the impression of common descent and explain all the other data.
Pim: Lacking any further evidence of common mechanism one has to reject Peter's suggestions. When Peter is able to propose similar theoretical and empirical foundations for his claims then we can do a comparison.
Peter: The more scientific evidence I present for NRM the harder you deny it. What debating tactics are these?
You have presented scientific evidence but none to strengthen your position about NRM. I am merely pointing out this failure.
Pim: Compelling Data for Common Descent from Matching Redundant DNA Sequences
Peter: This pertains a website and can not be considered scientific.
Just like your musings on NRM I suppose?
Pim: 29+ Evidences for Macroevolution The Scientific Case for Common Descent
Peter: This also pertains a web site. All molecular data shown here can be explained according the NRM hypothesis equally well or better. I do not see a problem here.
Other than the lack of any evidence to support your claims?
Let us know when your ideas are ready for a scientific comparison Peter.
More data yet to be explained by NRM
Sequences and Common Descent How We Can Trace Ancestry Through Genetics
the theory of common descent
Michael Behe
quote:
Many people think that questioning Darwinian evolution must be equivalent to espousing creationism. As commonly understood, creationism involves belief in an earth formed only about ten thousand years ago, an interpretation of the Bible that is still very popular. For the record, I have no reason to doubt that the universe is the billions of years old that physicists say it is. Further, I find the idea of common descent (that all organisms share a common ancestor) fairly convincing, and have no particular reason to doubt it. I greatly respect the work of my colleagues who study the development and behavior of organisms within an evolutionary framework, and I think that evolutinoary biologists have contributed enormously to our understanding of the world. Although Darwin's mechanism--natural selection working on variation--might explain many things, however, I do not believe it explains molecular life. I also do not think it surprising that the new science of the very small might change the way we view the less small." ~ Michael J. Behe, Darwin's Black Box, (New York: The Free Press, 1996), p. 7
Peter: So, I am on solid ground with my thesis that NRM may give the impression of common descent.
If solid ground means the absence of any evaluation of said data to show that it gives the impression of common descent then I would agree but it seems your solid ground may be just quicksand.
Until Peter provides some examples that show that NRM can explain the observed data better I once again have to conclude that I have to reject his interesting though unsupported claims. As I have said before I agree that NRM exists but so far Peter has done little to show that NRM will cause an appearance of common descent and can explain the observations better than the theory of common descent can.
And this repeat link
Heterogeneity of nucleotide frequencies among evolutionary lineages and phylogenetic inference., Rosenberg MS, Kumar S.Mol Biol Evol. 2003 Apr;20(4):610-21.
quote:
A major assumption of many molecular phylogenetic methods is the homogeneity of nucleotide frequencies among taxa, which refers to the equality of the nucleotide frequency bias among species. Changes in nucleotide frequency among different lineages in a data set are thought to lead to erroneous phylogenetic inference because unrelated clades may appear similar because of evolutionarily unrelated similarities in nucleotide frequencies. We tested the effects of the heterogeneity of nucleotide frequency bias on phylogenetic inference, along with the interaction between this heterogeneity and stratified taxon sampling, by means of computer simulations using evolutionary parameters derived from genomic databases. We found that the phylogenetic trees inferred from data sets simulated under realistic, observed levels of heterogeneity for mammalian genes were reconstructed with accuracy comparable to those simulated with homogeneous nucleotide frequencies; the results hold for Neighbor-Joining, minimum evolution, maximum parsimony, and maximum-likelihood methods. The LogDet distance method, specifically designed to deal with heterogeneous nucleotide frequencies, does not perform better than distance methods that assume substitution pattern homogeneity among sequences. In these specific simulation conditions, we did not find a significant interaction between phylogenetic accuracy and substitution pattern heterogeneity among lineages, even when the taxon sampling is increased.
See also Evolutionary Distance Estimation Under Heterogeneous Substitution Pattern Among Lineages Koichiro Tamura and Sudhir Kumar
or
Disparity Index: A Simple Statistic to Measure and Test the Homogeneity of Substitution Patterns Between Molecular Sequences Sudhir Kumar and Sudhindra R. Gadagkar Genetics 158: 1321–1327 ( July 2001)
and
Patterns of Transitional Mutation Biases Within and Among Mammalian Genomes Michael S. Rosenberg, Sankar Subramanian, and Sudhir Kumar
quote:
Significant transition/transversion mutation bias is a well-appreciated aspect of mammalian nuclear genomes; however, patterns of bias among genes within a genome and among species remain largely uncharacterized. Understanding these patterns is important for understanding similarities and differences in mutational patterns among genomes and genomic regions. Therefore, we have conducted an analysis of 7,587 pairs of sequences of 4,347 mammalian protein-coding genes from seven species (human, mouse, rat, cow, sheep, pig, and macaque) and from the introns of 51 gene pairs and multiple intergenic regions (37 kbp, 52 kbp and 65 kbp) from the human, chimpanzee, and baboon genomes. Our analyses show that genes and regions with widely varying base composition exhibit uniformity of transition mutation rate both within and among mammalian lineages, as long as the transitional mutations caused by CpG hypermutability are excluded. The estimates show no relationship to potential intrachromosomal or interchromosomal effects. This uniformity points to similarity in point mutation processes in genomic regions with substantially different GC-content biases.
and back to Heterogeneity of Nucleotide Frequencies Among Evolutionary Lineages and Phylogenetic Inference Michael S. Rosenberg and Sudhir Kumar
quote:
Our results reveal that the observed heterogeneity of nucleotide frequencies among mammalian lineages is likely to have little effect on the accuracy of the reconstructed phylogeny. These results were consistent for all methods examined, regardless of overall accuracy. This is not to say that heterogeneity will never cause errors; these errors are simply probably not as common as previously suggested, and other potential problems should be explored in more depth. Although the present results show that heterogeneity of nucleotide frequencies may not be as important a factor in phylogenetic analysis as often believed, accounting for heterogeneity is still an important aspect of many other evolutionary analyses, e.g., in the determination of substitution rates (Tourasse and Li 1999; Kumar and Subramanian 2002; Tamura and Kumar 2002).
[ 25. December 2003, 16:16: Message edited by: Pim van Meurs ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 26. December 2003 05:20
Pim, what do you not understand about NRM? That it will give a similar outcome as common descent with respect to molecular data? Or that it explains where NDT does not explain (example: ZFX/ZFY region in primates)? Please let me know and I will once more explain it to you.
The additional information you provided is welcome but since common descent and common mechanisms will yield similar data, and you did still not provide the key to discriminate between the two, such references do not really help our discussion. If you can provide the key I would be happy, and we can continue our little chat.
All I did is provide the scientific community with is a new hypothesis to understand the molecular data independent of common descent. What is wrong with that? Please let me know.
You should also realise that since evolutionary theory can be demonstrated to be wrong (see GUToB thread) the molecular data require a reinterpretation: NRM.
O yes, Lenski is old stuff. I recommend to read Rosenberg SM et al. She shows adaptive mutations to be induced by alternative polymerases that are induced as a response to the environment and the mutations are not random: there are "hotspots" and "cold spots". She desribes several mechanisms. pb [ 26. December 2003, 05:53: Message edited by: peter borger ]
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 26. December 2003 13:01
Peter: Pim, what do you not understand about NRM? That it will give a similar outcome as common descent with respect to molecular data?
It's not what I understand or not, it's that you have yet to show that it will give similar outcome as common descent. Simple.
Peter: Or that it explains where NDT does not explain (example: ZFX/ZFY region in primates)?
Again NDT can and does explain this so your remark is once again without merrit. See for instance An X-linked zinc finger gene mapping to Xq21.1-q21.3 closely related to ZFX and ZFY: possible origins from a common ancestral gene
quote:
We describe a new zinc finger gene sequence (CMPX1 or HGM symbol ZNF6; isolated by cross-hybridization of ZFY to clones in a testis cDNA library) which possesses a zinc finger domain closely related to the transcriptional activator gene ZFX. The putative acidic activation domain is only 11.5% homologous with ZFX, whereas the putative DNA binding domain shares 75% homology and shows the same organisation composed of a basic two fingered repeat unit. ZNF6 has an unusually large 5' untranslated region (UTR) of 1.2 Kb which contains 26 potential ATG initiation codons, only one of which is associated with a long open reading frame. Southern and Northern blot analysis has shown that this 5' UTR is shared with many other sequences in the genome and transcribed associated with a large range of mRNA species. In situ hybridisation, analysis of somatic cell hybrids and male individuals carrying deleted X chromosomes have mapped the gene to Xq21.1-q21.3. The gene is highly conserved amongst the primates, in the mouse and can be detected weakly in the genome of a metatherian mammal (possum). Dosage in male and female mice indicates that it is also X-linked in this species. Possible origins of ZFX, ZFY and CMPX1 from a common ancestral gene are discussed
and
quote:
Mol Biol Evol 2000 May;17(5):804-12 Related Articles, Links
Sex chromosomal transposable element accumulation and male-driven substitutional evolution in humans.
Erlandsson R, Wilson JF, Paabo S.
Max-Planck-Institute for Evolutionary Anthropology, Leipzig, Germany. riker1@biochem.kth.se
We sequenced the genomic region containing the human Y-linked zinc finger gene (ZFY). Comparison of ZFY to the related region on the X chromosome (ZFX) and to autosomal sequences reveals a significant accumulation of transposable elements on the sex chromosomes. In addition, five times as many retroviruslike elements (RLEs) are present in the ZFY region as in the ZFX region. Thus, transposable elements accumulate more rapidly on the sex chromosomes, and the insertion of RLEs may occur more frequently in the male than in the female germ line. When the accumulation of substitutions in Alu elements was analyzed, it was found that the Alu elements at the Y-chromosomal locus diverged significantly faster than those at the X-chromosomal locus, whereas the divergence of autosomal Alu elements was intermediate. The male-to-female mutation rate ratio was estimated to be 2.5.
or this paper which puts to rest many of Peter's claims
quote:
Evolution of the X-linked Zinc Finger Gene and the Y-linked Zinc Finger Gene in Primates Heui-Soo Kim (1) (*), Osamu Takenaka (2)
We have sequenced the partial exon of the zinc finger genes (ZFX and ZFY) in 5 hominoids, 2 Old World monkeys, 1 New World monkey, and 1 prosimian. Among these primate species, the percentage similarities of the nucleotide sequence of the ZFX gene were 96-100% and 91.2-99.7% for the ZFY gene. Of 397 sites in the ZFX and ZFY gene sequences, 20 for ZFX gene and 42 for ZFY gene were found to be variable. Substitution causes 1 amino acid change in ZFX, and 5 in ZFY, among 132 amino acids. The numbers of synonymous substitutions per site (Ks) between human and the chimpanzee, gorilla and orangutan for ZFY gene were 0.026, 0.033, and 0.085, respectively. In contrast, the Ks value between human and hominoid primates for the ZFX gene was 0.008 for each comparison. Comparison of the ZFX and ZFY genes revealed that the synonymous substitution levels were higher in hominoids than in other primates. The rates of synonymous substitution per site per year were higher in the ZFY exon than in the SRY exon, and higher in the ZFY exon than in the ZFY intron, in hominoid primates.
Peter: The additional information you provided is welcome but since common descent and common mechanisms will yield similar data, and you did still not provide the key to discriminate between the two, such references do not really help our discussion.
Since you have failed to show how NRM would explain the data and since I have shown that NRM would not affect the common descent inference, I would say that the ball is still in your court. If you have trouble supporting your thesis, just let us know and I will give you all the time you need to do the necessary scientific work.
Peter: All I did is provide the scientific community with is a new hypothesis to understand the molecular data independent of common descent. What is wrong with that? Please let me know.
Nothing other than the lackof supporting analyses? I am looking forward to you showing how NRM can cause apparant common descent and how NRM explains the vaste amounts of data supporting common descent. Seems common descent beats NRM time after time here.
Peter: You should also realise that since evolutionary theory can be demonstrated to be wrong (see GUToB thread) the molecular data require a reinterpretation: NRM.
Evolutionary theorey can be shown wrong of course but so far evolutionary theory has withstood much of such attemtps. NRM is not contradictory to evolutionary theory as I have shown, does not affect common descent inferences and thus your comments remain largely unsupported. Let us know when your ideas can be supported by the evidence Peter.
Merry Christmas
A good page on the latest on ZFY
This paper is also intruiging
Spatial and Temporal Distribution of the Neutral Polymorphisms in the Last ZFX Intron: Analysis of the Haplotype Structure and Genealogy Jadwiga Jaruzelska,Ewa Zietkiewicz, Mark Batzer, David E. C. Cole, Jean-Paul Moisan,Rosaria Scozzari,Simon Tavare and Damian Labuda
quote:
ABSTRACT With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions(inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.
Peter: O yes, Lenski is old stuff. I recommend to read Rosenberg SM et al. She shows adaptive mutations to be induced by alternative polymerases that are induced as a response to the environment and the mutations are not random: there are "hotspots" and "cold spots". She desribes several mechanisms.
Are you saying they were not random wrt location or with respect to immediate fitness? As I have shown these 'directed or adaptive' mutations appear to be quite Darwinian in nature.
Check out this paper by Rosenberg
link 1
or
link 2
Seems that this is just a variant of mutation and selection. What was remarkable is that this SOS response happened in response to environmental stress.
Here from a recent paper by Rosenberg
quote:
Global hypermutation in a subpopulation The data above do not address the controversial possibility that mutations might be directed preferentially to those genes that could favour survival in the selective environment7. This question was answered in the lac frameshift system by the discovery that mutations are not directed to58,76, or even to the same DNA molecule as58, the lac gene, which supports a random Darwinian process of mutation.
and
quote:
These results mean, first, that stationary-phase mutations in this system are not directed to the lac gene — both adaptive and neutral mutations are formed.
EVOLVING RESPONSIVELY: ADAPTIVE MUTATION Nature reviews Genetics JULY 2001 VOLUME 2 pp 504-515 [ 26. December 2003, 17:02: Message edited by: Pim van Meurs ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 08. January 2004 08:00
Happy new year Pim. To proof my point one would have to perform the analysis I have described before. That is a comparison of polymorphisms in homologous sequences obtained from for instance human and chimp. Unfortunately such studies have not been carried out a lot. I was able to track one down in literature. A study into the polymorphisms (SNP) in the FMR1 region, performed in 2001 in 20 humans and 2 chimps and 2 gorillas.
The one chimp polymorphism is also present in human, and this supports my thesis that shared mutations can be introduced in distinct orhganism on the same spot, independent of common descent. This is also obvious from the independent acquisition of the same polymorphism as chimp in asian, european and african populations. So, I proof my point: shared mutations do not say anything about common descent. Rather, they are evidence for common mechanisms that operate in similar multipurpose genomes.
It should also be realised that the study included only two chimps and 20 humans. I would like to see appearing in the literature studies comparing 20 chimps and 20 humans. I expect to find the same polymorphism in human and chimp, due to similar physicochemical and biochemical characteristics of MPGs that underly NRM.
Ref: Mathews et al. Sequence variation within the fragile X locus. Genome Research 2001, 11:1385.
http://www.genome.org/cgi/reprint/11/8/1382.pdf
pb
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 10. January 2004 14:38
Happy New Year Peter, despite my hopes to the contrary, I have come to the conclusion that further discussion with you is meaningless until you show in more than just assertions, how common mechanisms can generate common descent appearance and how such mechanisms are a better explanation of the data. Thus I will end my contributions to this thread and focus on more productive tasks. You may have the last word.
IP: Logged
|
|
|