ISCID Forums
Topic Closed  Topic Closed


Post New Topic  
Topic Closed  Topic Closed
my profile | search | faq | forum home
  next oldest topic   next newest topic
» ISCID Forums   » General   » Brainstorms   » Ontogenetic Depth and the Origin of Animals (Page 5)

 
This topic is comprised of pages:  1  2  3  4  5  6  7  8  10  11  12 
 
Author Topic: Ontogenetic Depth and the Origin of Animals
Paul A. Nelson
Member
Member # 26

Icon 1 posted 11. February 2003 17:29      Profile for Paul A. Nelson   Email Paul A. Nelson   Send New Private Message       Edit/Delete Post 
Yersinia wrote:

quote:
If many genes gave the same unexpected patterns then we would conclude that something very different than common descent had happened.
Well, I guess that's the best I'm going to get.

Would you agree with this summary of your position?

1. Some biological patterns are consistent with (and best explained by) common descent, because a natural pathway from a common ancestor exists, linking the patterns by descent with modification.

2. Other biological patterns (if observed) would be inconsistent with common descent. These patterns could not have descended in a natural pathway from a common ancestor.

Lastly, would you agree that the possibility of discovering patterns in class (2) tests common descent? In other words, it must be at least possible to discover patterns that fall under (2), whether such patterns (data) are observed or not.

IP: Logged
charlie d.
Member
Member # 159

Icon 1 posted 11. February 2003 20:53      Profile for charlie d.     Send New Private Message       Edit/Delete Post 
Paul:
I see the topic has shifted from "ontogenetic depth" to GE and the "marching band" problem. To me, they seem rather separate issues, at least from an investigational point of view, but anyway.

I have a couple of questions. GE clearly is a quantitative variable. So, while I would agree with you that absolute GE (no significant developmental transitions possible) and common descent are mutually exclusive, anything less than absolute GE is in fact compatible with CD. After all, only so many major body plan changes have occurred throughout the 1 billion years and gazillion organisms-generations chances multicellular life on earth has provided to evolution (and some of those changes may not have been so major after all - see shrimp legs).

So, I was wondering what the evidence (not just the theoretical ruminations) for GE is, and whether that evidence points to absolute, or less-than-absolute GE.

Second, assuming such evidence for absolute GE exists, I was wondering if it'd also be compatible with less-than-absolute GE. The reason being, of course, that dispensing with CD would leave us with tons of data inexplicable without wild gyrations (such as Josh's claim that pseudogenes may be under strong selective pressure after all, or the idea that a designer may want to faithfully, but unnecessarily, imitate CD), while dispensing with absolute GE would likely simply leave us with less-than-absolute GE.

To me, the functionally (not philosophically) axiomatic nature of CD is simply a matter of parsimony. We wouldn't even know where to start to explain the millions of independent pieces of data supporting CD, if CD did not exist (of course, if anybody did come up with a valid alternative, it should be listened to). On the other hand, we can dispense with absolute GE, retain less-than-absolute GE, and still not totally freak out (assuming the evidence is compatible with both, that is).

[ 11. February 2003, 23:27: Message edited by: charlie d. ]

IP: Logged
yersinia
Member
Member # 324

Icon 1 posted 12. February 2003 06:11      Profile for yersinia     Send New Private Message       Edit/Delete Post 
Hi Paul,

quote:

Would you agree with this summary of your position?

1. Some biological patterns are consistent with (and best explained by) common descent, because a natural pathway from a common ancestor exists, linking the patterns by descent with modification.

2. Other biological patterns (if observed) would be inconsistent with common descent. These patterns could not have descended in a natural pathway from a common ancestor.

I think you are confusing "patterns" with "features". A nested hierarchy is a pattern, it does not descend from anything. Genes, developmental programs, etc. are what do the descending.

With that caveat, I think I know what you mean, however. I would say:

1. Some biological patterns are consistent with (and best explained by) common descent, because they are what we would expect to see if common descent had actually occurred (and these patterns are what we actually see when we have directly observed common descent occuring).

2. Some biological *features* (if observed) would be inconsistent with common descent. These features could not have originated in a natural pathway from a common ancestor lacking these features. [putative examples would include irreducible complexity and certain kinds of changes in developmental pathways]

So that is how I would put your statement in my own words. I of course think that claims along the lines of #2 have yet to hold up for anything actually found in biology. Douglas Adams' Babel fish, if found, would however be a great example of #2, so instances of #2 are certainly hypothetically possible.

However you might have meant:

3. Some biological patterns are not consistent with (or best explained by) common descent, because they are not what we would expect to see if common descent had actually occurred, and instead are the expected result of alternative processes X, Y, Z, etc., and perhaps have even been observed as being the result of directly observed process X. For instance, the human design process is known to produce massive and ubiquitous violations of nested hierarchy -- e.g., the transplant of dozens of new electronics systems, safety features, etc. into hundreds of separate "lineages" of cars), and all of these cross-lineage system transfers occur in a pattern conforming to various human desires, e.g. convenience, government regulations, saving money on gasoline, etc.

quote:

Lastly, would you agree that the possibility of discovering patterns in class (2) tests common descent? In other words, it must be at least possible to discover patterns that fall under (2), whether such patterns (data) are observed or not.

This last chunk seems to correspond better to my possibility #3, so sure, the possibility of weakening the common descent hypothesis by a test clearly exists. The ubiquitous massive nested hierarchy violations for basically all features of automobiles, for example, precludes their having been produced by a process of common descent. The T.O. common descent FAQ lists a bunch of references to articles where known common descent processes produced nested hierarchies and known non-common descent processes did not.
IP: Logged
yersinia
Member
Member # 324

Icon 1 posted 12. February 2003 06:27      Profile for yersinia     Send New Private Message       Edit/Delete Post 
A rather amazingly relevant article from Feb. 2003 Nature Genetics:

quote:

Nat Genet 2003 Feb;33(2):138-44

Evolution of gene expression in the Drosophila melanogaster subgroup.

Rifkin SA, Kim J, White KP.

[1] Department of Ecology and Evolutionary Biology, Yale University, PO Box 208106, New Haven, Connecticut 06520-8106, USA. [2] Department of Genetics, Yale University School of Medicine, PO Box 208005, New Haven, Connecticut 06520-8005, USA.

Little is known about broad patterns of variation and evolution of gene expression during any developmental process. Here we investigate variation in genome-wide gene expression among Drosophila simulans, Drosophila yakuba and four strains of Drosophila melanogaster during a major developmental transition -- the start of metamorphosis. Differences in gene activity between these lineages follow a phylogenetic pattern, and 27% of all of the genes in these genomes differ in their developmental gene expression between at least two strains or species. We identify, on a gene-by-gene basis, the evolutionary forces that shape this variation and show that, both within the transcriptional network that controls metamorphosis and across the whole genome, the expression changes of transcription factor genes are relatively stable, whereas those of their downstream targets are more likely to have evolved. Our results demonstrate extensive evolution of developmental gene expression among closely related species.

[...]

Discussion

Phenotypic evolution is both constrained and driven by variation in gene function during development. Because gene expression itself varies, it is an object of evolution in its own right [36]. Determining the proximate causes of this variation—the interactions between trans-regulatory factors and cis-regulatory sequences—will be crucial for understanding how differences in gene function drive the evolution of multigenic traits [37, 38]. In the D. melanogaster subgroup, developmental changes in gene expression vary extensively both within and between species. This variation provides abundant targets for selection and ample fuel for evolution.

Much of the genome-wide variation in expression results from changing developmental constraints, which shift the balance between different evolutionary forces. There are stronger constraints on the activation of gene expression than on the downregulation or degradation of transcripts during development. There are stronger constraints on the expression of genes that encode regulatory molecules than on the expression of genes that encode structural factors or enzymes. There are stronger constraints on genes with small changes in expression during development than on those with larger changes. Because of these constraints, interpreting the biological significance of gene expression variation and evolution will be difficult or impossible outside its developmental context.

[bolds added]

In short, the authors studied gene expression during the "major developmental transition" of metamorphesis in Drosophila. Surprisingly (based on what Paul Nelson has been telling us in this thread), they discovered substantial differences in gene expression both between Drosophila species and within species, between strains of Drosophila melanogaster.

Looks like changes in a "major developmental transition" are, after all, known and documented and hereditable to boot. To save his thesis Paul would now have to argue that different strains of Drosophila melanogaster do not share common ancestry. This is, of course, his prerogative. [Smile]

[ 12. February 2003, 06:29: Message edited by: yersinia ]

IP: Logged
Paul A. Nelson
Member
Member # 26

Icon 1 posted 12. February 2003 10:24      Profile for Paul A. Nelson   Email Paul A. Nelson   Send New Private Message       Edit/Delete Post 
Yersinia,

Thanks for your thoughtful clarifications.

[First, about the Drosophila study. Let's have a fly geneticist put a mix of larvae and healthy adult flies, from the study cited -- including Drosophila melanogaster, Drosophila simulans, and Drosophila yakuba -- into a population cage. You and I will pick out the "major" variants. [Wink]

All joking aside, development certainly does vary, and much of that variation is heritable. I've never said otherwise. I've got a golden retriever; my neighbor has a little fuzzy white mutt; my other neighbor has a medium-sized yellowish mutt. Their pronounced phenotypic differences have a heritable developmental basis. As Charlie notes above, GE is a quantitative feature of development, and the important question is how much does development vary. Please, try to argue with me, and not a sand-bottom-clown Paul Nelson who is fun to punch with cheap shots.

OK, back to Heliocidaris.]

I'll use your own phrasing:

quote:
1. Some biological patterns are consistent with (and best explained by) common descent, because they are what we would expect to see if common descent had actually occurred (and these patterns are what we actually see when we have directly observed common descent occuring).

2. Some biological *features* (if observed) would be inconsistent with common descent. These features could not have originated in a natural pathway from a common ancestor lacking these features.

Although you omitted the words from your restatement of my #1, I think you would agree that it is implicit, indeed necessary (in category 1) that a natural pathway exists, linking the characters or features constituting those biological patterns best explained by common descent. Otherwise, it is hard to see what "common descent" or "common ancestry" could possibly mean.

Now, into which category do the embryonic differences between H. erythrogramma and H. tuberculata fall?

[ 12. February 2003, 11:08: Message edited by: Paul A. Nelson ]

IP: Logged
Paul A. Nelson
Member
Member # 26

Icon 1 posted 12. February 2003 10:34      Profile for Paul A. Nelson   Email Paul A. Nelson   Send New Private Message       Edit/Delete Post 
Hi Charlie,

You wrote:

quote:
I have a couple of questions. GE clearly is a quantitative variable. So, while I would agree with you that absolute GE (no significant developmental transitions possible) and common descent are mutually exclusive, anything less than absolute GE is in fact compatible with CD. After all, only so many major body plan changes have occurred throughout the 1 billion years and gazillion organisms-generations chances multicellular life on earth has provided to evolution (and some of those changes may not have been so major after all - see shrimp legs).
Well, maybe. On the other hand, even much-less-than-absolute GE might overturn CD, depending on how the chances (probabilities) shake out. You're right of course that GE is a quantitative variable.

quote:
So, I was wondering what the evidence (not just the theoretical ruminations) for GE is, and whether that evidence points to absolute, or less-than-absolute GE.
In conversations with evo-devo acquaintances who think about this topic, I often encounter a certain impatience when I ask about candidate violations of GE. "Isn't it just obvious," people say, "that we shouldn't expect to see such violations? Rare events are, by definition, rare. If Drosophila, for instance, responded to mutagenesis by thriving with two, instead of three, major body segments, then Wimsatt and Riedl and the others would never have come up with concepts like 'burden' or 'generative entrenchment.'" [Their underlying message: try not to ask stupid questions.]

So the evidence for GE is what the model systems of developmental biology have told us over the past many decades, to the (worrisome) degree that workers don't really bother to organize the evidence in a systematic way. I say "worrisome" because rare events are easy to miss, especially when what's obvious to everyone -- don't look for viable macromutations, they don't happen in the time frame available to geneticists -- may be biasing scientififc perception.

Still, there does seem to be a consistent signal returning from the experimental perturbation of organisms like Danio, Drosophila, C. elegans, and so on. It's instructive, for instance, to page through the appendix of the zebrafish special issue that Development published back in 1996, listing the embryonic lethals vs. adult viables. Even the embryonic lethals are recognizably zebrafish. Mutations that would heritably shift development out of the vertebrate or even Danio body plan are simply never observed, in any form at all.

At that level, as far as we know, GE is absolute.

quote:
Second, assuming such evidence for absolute GE exists, I was wondering if it'd also be compatible with less-than-absolute GE.
That's the million-dollar question, isn't it. And that's where most of the argumentation has gone: We can bet on a rare chance when we have lots of time, lots of organisms, and things might have been different in the Precambrian. But when one asks for the content (for instance) of the notion of a "labile" Precambrian metazoan genome or developmental architecture, precious few details are supplied.

Anyway, to take a couple of steps back: CD is a powerful, elegant, unifying theory, so it doesn't surprise me that GE takes the hit. As you write:

quote:
To me, the functionally (not philosophically) axiomatic nature of CD is simply a matter of parsimony. We wouldn't even know where to start to explain the millions of independent pieces of data supporting CD, if CD did not exist (of course, if anybody did come up with a valid alternative, it should be listened to). On the other hand, we can dispense with absolute GE, retain less-than-absolute GE, and still not totally freak out (assuming the evidence is compatible with both, that is).
There's plenty of evidence that is hard, or really impossible, to reconcile with CD, but it's not recognized as such because the grip of CD on the collective biological imagination is so complete.

Nevertheless I agree wholeheartedly that casting doubt on CD puts one immediately to sea, far out to sea in deep water, in a way that is profoundly dissatisfying. Most biologists take that feeling of dissatisfaction as an indication that they've ventured into the realm of the unscientific or unreasonable, so they don't go there. And I can't say that I blame them, really.

I guess that why I'm a philosopher! We can't help but ask the stupid questions.

[ 12. February 2003, 10:42: Message edited by: Paul A. Nelson ]

IP: Logged
Argon
Member
Member # 276

Icon 1 posted 12. February 2003 11:06      Profile for Argon   Email Argon   Send New Private Message       Edit/Delete Post 
Paul Nelson writes:
"But nothing is incompatible with such a theory. GE observations do challenge good old ordinary common descent, which is a scientific theory that makes testable predictions.

Any possible observation is compatible with descent plus design to get over the hard patches, which is the reason Darwin (rightly) regarded such ideas with contempt. Show me a theory of common descent plus design that makes specific predictions about whether GE should hold, or not, and then we'll have something to talk about."

Three comments:
1) I agree that in principle, anything is possible with design. But no one really believes that "anything" can happen; at least not in the sense that a design-based universe is incoherent and "unmappable". So, some sort of connecting, "narrative coherence" is a fundamental axiom without which no other bundles of hypotheses can be tested. What this boils down to is the faith (I guess) that rational, logic beings can make some sense of the world and the patterns we see actually exist. Philosophy would be just as dead as science in a world where this didn't apply. Parsimony, though not a perfect criterion, is an additional tool for evaluating patterns.

2) TRIZ, IC, Specified Complexity and the Explanatory Filter have all been proposed as tools for finding the "hard patches" where design intervention is required. Basically, when you've ruled out the possible (e.g. natural explanations), the "impossible" (non-"natural") remains. I have argued in the past about the success of applying these tools to specific cases but to date, they remain just about the only major areas developed by ID workers. If GE is a real block for natural mechanisms, why shouldn't we be able to evaluate it using the above tools? Are the developmental pathways in the two species of sea urchins IC? I think so: These are multicomponent systems with demonstrated susceptibilities to perturbation. Do they demonstrate specified complexity? Well, William Dembski provided and example of how he would calculate that for biological systems like the flagellum. Certainly one could collect parallel data on the number of likely interactions involved in development and run some quick probability calculations _exactly_ as Dembski did. If we use Dembski's example as a prototype I think one could easily determine a lower limit to the number of systems that would have to be in just the right place at just the right time, and I suspect that the number of components involved exceeds that of the flagellar system. If this method isn't legitimate, we should contact Dembski. Finally, TRIZ is employed as a model of how _comprehensible_ designers may operate to "solve" the problem of implementing a modified developmental pathway. Common descent is invoked because it is the most parsimonious explanation that is coherent with the vast majority of comparative data when design "events" are clearly not involved.

3) Since ID is indeed a matter of getting "over the hard patches" in terms of explanation, what does this say about how we should regard such ideas? Granted, ID, as opposed to simple "anti-evolutionism", has not had as long a development phase to deliver on its substantial number of promises and so perhaps we shouldn't expect very much. Perhaps you are right in that we should hold such efforts in contempt until it succeeds.

IP: Logged
Paul A. Nelson
Member
Member # 26

Icon 1 posted 12. February 2003 11:20      Profile for Paul A. Nelson   Email Paul A. Nelson   Send New Private Message       Edit/Delete Post 
Argon wrote:

quote:
If GE is a real block for natural mechanisms, why shouldn't we be able to evaluate it using the above tools?
We should be able to evaluate it using design tools, but it may then turn out that design and common descent (which postulates the existence of a natural pathway) are going to be pulling in opposite directions.

I'm pretty sure that Yersinia and Charlie D do regard development in Heliocidaris as fully explicable by natural mechanisms, sooner or later. In that respect, their position reflects the mainstream (evolutionary) view of the matter. They would see design explanations as fundamentally at odds with common descent, if the former theories have any empirical content distinct from common descent.

I apologize that my last reply to you was curt. [Frown] When I think about the theory of common descent, it's as a naturalistic theory, and it's hard for me to get my mind around other approaches (namely, descent + design).

IP: Logged
Argon
Member
Member # 276

Icon 1 posted 12. February 2003 11:52      Profile for Argon   Email Argon   Send New Private Message       Edit/Delete Post 
Paul writes:
"I apologize that my last reply to you was curt. When I think about the theory of common descent, it's as a naturalistic theory, and it's hard for me to get my mind around other approaches (namely, descent + design)."

Mea culpa. You were probably curt in part because I was being a pedantic asshole.

Note to moderators: I defend the use of such a derogatory term because is self-applied... and judging from its universal use in every lab, it's a well-established, scientific term as well.

Have fun in CT. I see it just finished snowing there.

As for "natural" pathways: Recall that Dembski suggested information is injected in quantum events to avoid breaking "natural laws". This results in modification of previously existing systems: i.e. common descent with modification.

IP: Logged
charlie d.
Member
Member # 159

Icon 1 posted 12. February 2003 12:12      Profile for charlie d.     Send New Private Message       Edit/Delete Post 
quote:
There's plenty of evidence that is hard, or really impossible, to reconcile with CD, but it's not recognized as such because the grip of CD on the collective biological imagination is so complete.
That's just a cheap shot, Paul. Instead of making an unsupported claim, try listing some of this evidence that supposedly is hard, or really impossible, to reconcile with CD, then maybe there'll be something to discuss. Right now, I can't actually think of any evidence incompatible with CD, but only of an array of negative claims and/or arguments from incredulity (and by your own admission, even a theoretically solid one like GE actually falls far short). Yet, as discussed above, there would be many clear-cut ways for actual evidence to falsify CD, either for specific taxa, or for all organisms; indeed, this could have happened at dozens of junctures in the past 150 years, as our knowledge of biology and the history of life progressively increased.

Appealing to some sort of mass delusion (and more or less subconscious "burying" of evidence, to boot) to explain why arguments against CD consistently fail to take hold in the scientific community is just a weak way out of actually analyzing the available evidence, IMO.

I agree with Argon on one thing: it'd be a great improvement if CD-deniers (of various stripes) spent their time collecting the actual evidence (in this case, for instance, identifying and characterizing developmentally important genes, elucidating their activity pathways, and comparatively studying their properties in different organisms), rather than just heckling from the scientific sidelines. At least it would suggest a honest try to participate in the game and to find out the answers.

[ 12. February 2003, 12:35: Message edited by: charlie d. ]

IP: Logged
Paul A. Nelson
Member
Member # 26

Icon 1 posted 12. February 2003 15:34      Profile for Paul A. Nelson   Email Paul A. Nelson   Send New Private Message       Edit/Delete Post 
I said:

quote:
There's plenty of evidence that is hard, or really impossible, to reconcile with CD, but it's not recognized as such because the grip of CD on the collective biological imagination is so complete.
Charlie replied:

quote:
That's just a cheap shot, Paul.
With those pleasant words ringing in my ears, I have to leave for lectures at Andrews University, the Univ. of CT, Dartmouth, and Northeastern. I'll try to post the dates/times/locations here for anyone who is interested. As always, I love to meet people interested in this topic, whatever their views. If you can spare the time, please come by and say hello.

I'll be back to this thread on Friday, Feb. 21.

P.S. to Charlie: The evidence isn't hard to find. You just have to look, but looking means taking off the CD spectacles, at least provisionally. More on this next Friday.

IP: Logged
Josh
Member
Member # 405

Icon 1 posted 12. February 2003 15:37      Profile for Josh   Email Josh   Send New Private Message       Edit/Delete Post 
Charlie-

I think the papers Yersinia and I posted outline the general approaches that will serve to quantify the concepts of onological depth and GE, as well as answer some of these other issues discussed. As always, the real tricky task of science boils down to proper interpretation of the evidence. Its fairly easy to see a band on a gel or a read a DNA sequence or whatever. It is quite another thing to determine the common ancestry of biological life, etc. People "on the sidelines" will offer just as valuable a service as those with wet feet in the lab, IMO, because interpretation is difficult and often can be biased by many factors by those doing the work themselves. Besides, challengers to common interpretations often provoke experimentalists to prove their point with much more clarity. Trying to stultify those with insight into a problem is generally not as beneficial as letting those folks say their piece and then prove them right/wrong. I would offer that if this issue was in fact PROVEN, Paul wouldn't be saying anything about it. So whoever does the work, in the end we won't have to discuss the controversy because there will be none. By the way, isn't this forum entirely a "sidelines" enterprise? Very little published data occurs here.

IP: Logged
charlie d.
Member
Member # 159

Icon 1 posted 12. February 2003 16:22      Profile for charlie d.     Send New Private Message       Edit/Delete Post 
Josh:
I am not saying that theoretical discussions are worthless. I am just saying that when theoretical arguments are all one gets from one side, with little or nothing in the actual pursuit of original evidence, and lots of negative claims built mainly, if not uniquely, on the absence of evidence, the situation becomes not much unlike quarterbacking from the sidelines.

For instance, the issue about GE is a legitimate, indeed interesting theoretical question, that can at least in part be addressed empirically. However, it is hard to deny that in the case of Heliocidaris, some good reasons exist to infer a close phylogenetic relationship, based on anatomical, genetic and biological similarities. If somebody then wants to raise the possibility that such close phylogenetic relationship does not exist (indeed, that there is no such thing as a phylogenetic relationship), is it unreasonable to expect a little more than just a "that's not enough" or a "what if" argument? Something like an answer to the question: What would one predict from absence of CD between Heliocidaris species? and: Are such predictions verified?

As for Paul's CD-busting evidence, I guess we'll have to wait. I'd have thought that evidence that is "impossible to reconcile with CD", would be also refractory to CD spectacles, binoculars or telescopes...

IP: Logged
yersinia
Member
Member # 324

Icon 1 posted 13. February 2003 03:53      Profile for yersinia     Send New Private Message       Edit/Delete Post 
I guess here's what I don't get. Earlier in this thread Paul was asking for evidence for the hereditability of variation in early development, implying that the lack of this evidence was a major point against common descent:

quote:

But animals do develop in very different ways, from the earliest stages forward. Thus, if common descent is true [remember that assumption], early development must vary heritably somehow. But how?

Evidence that early developmental stages vary heritably is almost always comparative. That is, an author assumes that two or more groups share a common ancestor (see my comments on Heliocidaris, below); those groups exhibit early embryonic differences; therefore, variation or mutation in early development is heritable.

Consider, for instance, the following passage from Raff and colleagues (1991, 189):

quote:
--------------------------------------------------------------------------------
...early development is often held to be particularly subject to constraint, and thus to be highly conserved in evolution.
--------------------------------------------------------------------------------

There's plenty of experimental support for this, and that support was the main reason classical neo-Darwinism avoided postulating macromutations.

But Raff et al. continue:

quote:
--------------------------------------------------------------------------------
Yet early development does evolve, and sometimes dramatically.
--------------------------------------------------------------------------------

OK -- what's the evidential basis for this claim? Well, it's not experimental. Developing organisms typically respond to early-acting mutations by dying (embryonic lethals).

The evidential basis is the assumption of common descent -- an assumption that here, as elsewhere in historical biology, is not up for grabs.

(bolds added)

Respondents have shown that common descent of the two species in question is not, in fact, an assumption, but based on diverse sources of data conforming to specific predictions. Paul has not provided an alternative hypothesis that makes similarly explicit predictions. He has not provided an alternative explanation for any of this data. He has not explained why even the baraminologists' hyperskeptical criteria, which certainly don't "assume" common descent but which would still score Heliocidaris species as having a common ancestor, are *still* not good enough for him. Until he gives these explanations has he given common descent supporters any reason to change their mind?

At best Paul has argued that certain vaguely-defined developmental transitions are impossible. His evidence for this is that "Developing organisms typically respond to early-acting mutations by dying (embryonic lethals)". But when provided with a study showing rather a lot of variation in just such a key, early, pre-reproductive, developmental transition in Drosophila (metamorphasis from larva to adult form), Paul now tells us that what he wants are major variations:

quote:
First, about the Drosophila study. Let's have a fly geneticist put a mix of larvae and healthy adult flies, from the study cited -- including Drosophila melanogaster, Drosophila simulans, and Drosophila yakuba -- into a population cage. You and I will pick out the "major" variants.
Now, I appreciate the tongue-in-cheek ( [Smile] ), but why didn't it occur to Paul that perhaps major variations are not necessary, and evolutionary changes in development can occur gradually, by the selection of many small changes!![b] Since when did NeoDarwinism depend on macromutations???

[b]Paul has assumed throughout that major developmental changes must be due to macromutations, but this is not what anyone is arguing!!!


These kinds of variations are found even at the earliest stages of development in Drosophila (biology rule #1: anything you're interested in has been studied the most in Drosophila):

quote:

(all bolds added)

Proc Natl Acad Sci U S A 2000 Jan 4;97(1):212-6

Molecular heterochrony in the early development of Drosophila.

free online BTW

Kim J, Kerr JQ, Min GS.

Department of Ecology, Yale University, 165 Prospect Street, New Haven, CT 06511, USA. junhyong.kim@yale.edu

Heterochrony, the relative change of developmental timing, is one of the major modes of macroevolutionary change; it identifies temporally disassociated units of developmental evolution. Here, we report the results of a fine-scale temporal study for the expression of the developmental gene hairy and morphological development in three species of Drosophila, D. melanogaster, D. simulans, and D. pseudoobscura. The results suggest that between and among closely related species, temporal displacement of ontogenetic trajectory is detected even at the earliest stage of development. Overall, D. simulans shows the earliest expression, followed by D. melanogaster, and then by D. pseudoobscura. Setting D. melanogaster as the standard, we find the approximate time to full expression is accelerated by 13 min, 48 s in D. simulans and retarded by 24 min in D. pseudoobscura. Morphologically, again with D. melanogaster setting the standard, initiation of cellularization is faster in D. simulans by 15 min, 42 s; and initiation of morphogenesis is faster in D. simulans by 18 min, 7 s. These results seem to be consistent with the finding that the approximate time to full expression of hairy is accelerated by 13 min, 48 s in D. simulans. On the other hand, the same morphological events are delayed by 5 min, 32 s, and by 11 min, 32 s, respectively, in D. pseudoobscura. These delays are small, compared with the 24-min delay in full expression. The timing changes, in total, seem consistent with continuous phyletic evolution of temporal trajectories. Finally, we speculate that epigenetic interactions of hairy expression timing and cell-cycle timing may have led to morphological differences in the terminal system of the larvae.

[...]

Heterochrony has been most widely studied in terms of morphological evolution, especially with respect to terminal characters (for recent examples, see refs. 31–35). However, Raff (15) has pointed out that heterochrony can be found in earlier as well as in later stages of development. Indeed, changes in developmental timing in the early stages of ontogeny has been described in many studies (6, 36–39). Furthermore, Richardson et al. (40) argue that previous notions of phylotypic stages are based on an incomplete analysis of comparative data, and they suggest that there are no particularly conserved stages of development. In our study, we show that statistically significant developmental timing changes can be detected in the earliest part of the ontogenetic trajectory; hairy is one of the first zygotically expressed genes. Klingenberg (29) notes that modern developmental biology resurrects Haeckel's original meaning of heterochrony (reversals in the order of appearance), compared with the speeding-up or the slowing-down of a particular trajectory. We note that our measurement of heterochrony is a quantitative measurement of the temporal trajectory at the molecular level; it is not merely a measurement of the qualitative sequence of gene expression.

[...]

In summary, we report heterochronic change in the expression trajectory of a developmental gene in the earliest stage of development. The degree of change seems to be consistent with continuous phyletic evolution of temporal trajectories. We speculate that epigenetic interactions of hairy expression timing and cell-cycle timing may have led to morphological differences in the terminal system of the larvae. These results suggest to us that epigenetic interactions of temporal trajectories between molecular cascades can be an important diversifying mechanism at the macroevolutionary level.

And there is significant support for the notion that an accumulation of small regulatory changes are the main force behind morphological evolution. Note all these cases of hereditable change in complex, multipart, integrated developmental processes, and yet a fairly detailed understanding of their recent evolutionary change has been developed:

(John Bracht might like the one where a new gene is integrated into a pre-existing pathway, since over on the Evolving Inventions thread he asserted that this couldn't happen naturally.)

quote:

Nature Reviews Genetics 3, 907 (2002);

EVOLUTION OF DEVELOPMENT IN CLOSELY RELATED SPECIES OF FLIES AND WORMS

Pat Simpson

Link to article

Change over a small evolutionary timescale

If evolution proceeds in small steps, and large changes in gene activity result from several smaller changes at the same locus, then it is important to identify the small changes that might have been individually selected. To do this, a small evolutionary timescale needs to be looked at, by studying closely related species. This approach has the advantage that subtle differences, such as those that might arise from one or a small number of evolutionary steps, can be compared between species. It also allows the design of cross-species functional assays that are likely to be less susceptible to experimental artefacts, which is a concern when comparing species with more-diverged embryonic morphologies. The use of the satellite species of D. melanogaster and C. elegans offers the potential to use the huge amount of genetic information that is available for these model organisms. As for comparisons between distantly related organisms, candidate genes can be selected for analysis. However, in cases where hybrids are viable, empirical genetic analysis can help to identify the underlying variation. Here, I discuss four studies that use either a candidate-gene approach or classical genetics.

Cis-regulatory change at a fly Hox locus. In Drosophila, Ubx is responsible for the morphological difference between the second and third thoracic segments. To achieve this, Ubx regulates many traits through many different targets37. High levels of Ubx at the proximal end of the femur of the second leg of D. melanogaster repress TRICHOME development to give a small hairless patch38. D. virilis, which has no naked patch, has correspondingly lower levels of Ubx. Levels of Ubx in D. simulans are similar to those in D. melanogaster, although D. simulans has a larger naked patch. By exploiting the fact that hybrids between D. simulans and D. melanogaster are viable, Stern showed that the trichome phenotype of hybrids, which result from the activity of a single wild-type Ubx allele, differed depending on which species the allele had come from — the D. melanogaster allele causes a smaller patch than that of D. simulans38. As the proteins from the two species are identical, this variation is presumed to have arisen from differences in the cis-regulatory control of gene expression38.

Change at a nematode Hox locus. This example concerns the gene lin-39, the nematode homologue of Deformed, a Hox gene that is involved in the development of the head in Drosophila39. Free-living nematodes, such as C. elegans, have a defined number of cells and develop from invariant cell lineages40 (Box 1). This simplicity means that various developmental processes can be studied at a cellular resolution that is not possible in most other metazoa and that homologous cells can be recognized between species. Development of the nematode vulva is a well-defined process. Three specific cells, P5.p–P7.p, form the vulva of C. elegans, and are singled out from the 12 ventral epidermal precursor cells by a process of induction (Box 2; for a review, see Ref. 41). The vulva of Pristionchus pacificus — an established satellite species that is separated from C. elegans by 100 Myr — also forms from P5.p–P7.p. However, whereas the vulval fate in C. elegans is induced by a short burst of signal from a specific cell in the gonad, in P. pacificus it occurs in response to a continuous signal from many cells of the somatic gonad42 (Box 2; for a review, see Ref. 43).

In C. elegans, lin-39 is expressed in cells of the vulval equivalence group P3.p–P8.p44, 45 (Box 2). lin-39 is required early to prevent these cells from fusing with the hypodermis and later, during vulval induction, it is upregulated in P5.p–P7.p to specify vulval fates. In P. pacificus, the vulval equivalence group comprises P5.p–P8.p, and lin-39 is only required once — at an early stage — to prevent cell death (Box 2). LIN-39 proteins of C. elegans and P. pacificus are highly conserved in the hexapeptide and homeodomain regions, which are required for DNA binding, but have diverged in other regions46. Nonetheless, when expressed from the C. elegans lin-39 promoter, LIN-39 protein from P. pacificus can rescue lin-39 functions in C. elegans which it does not usually carry out46. This indicates that the difference in function of the LIN-39 protein between species is attributable to the different cellular contexts of the species in which they operate. In turn, this indicates that the differences between the two species reside in regulatory, rather than coding sequence46. Therefore, as in other organisms, changes in the function of nematode Hox genes can underlie evolutionary changes in cell behaviour.

[attention John Bracht for the below section]

Integration of pathways by a newly evolved gene. A study by Kopp and colleagues combines the knowledge of a genetic network in D. melanogaster with the expression patterns of candidate genes in other drosophilid species to uncover the molecular basis for sex-specific differences in fly pigmentation47. In D. melanogaster, the abdominal segments A5 and A6 are strongly pigmented in males but not in females; this is a recently evolved trait48. Mutation of the Hox gene Abdominal-B (AbdB) causes a loss of pigmentation in males, whereas mutations in bric à brac (bab) and doublesex (dsx) lead to a pigmentation of female abdomens. Using transgenic flies, the authors showed that AbdB represses bab in both sexes, but in females this repression is prevented by the female-specific form of dsx, dsxF (Fig. 2). Therefore, the transcription factor that is encoded by bab is only expressed in females where it represses pigmentation. A cross-reacting antibody was used to show that, in the D. melanogaster species group, bab is expressed in females of species with male-specific pigmentation, but not in segments A5 and A6 of males. By contrast, in all MONOMORPHIC SPECIES, Bab is present in both sexes, so its role in antagonizing AbdB function and repressing pigmentation is ancestral. However, because there is evidence that, ancestrally, bab expression was independent of dsxF and AbdB, this gene must have only recently evolved to integrate input from these two distinct genetic pathways47, 48. The authors propose that this is attributable to changes in the cis-regulatory region of bab, and point out that this circuit is flexible and highly evolveable47. The phenotype depends on the levels of bab expression, which, in turn, depends on the balance between the inputs from AbdB and dsx.

Change in a newly identified gene. Hybrids between closely related species of drosophilids can be used to identify the genes that are responsible for small phenotypic differences. The dorsal cuticle of larvae of the melanogaster subgroup of Drosophila has an anterior lawn of fine hairs in all species except D. sechellia49. From interspecific crosses, Sucena and Stern determined that a single X-linked locus was responsible for this trait. By using an overlapping set of X-chromosomal deletions from D. melanogaster and recombination mapping, they were able to map the position of this gene to a small chromosomal interval. This interval contains the D. melanogaster gene ovo/shavenbaby (ovo/svb), which, when mutated, causes a patterned loss of dorsal hairs50, 51. The mutant failed to COMPLEMENT the phenotype of D. sechellia in melanogaster/sechellia hybrids. Different levels of ovo/svb transcripts correlated with the patterns in the two species, indicating that the phenotypic differences between D. sechellia and the other species are caused by changes in the way that their cis-regulatory regions function49. This study illustrates how decades of accumulated knowledge of the genetics of this model organism can be harnessed to identify rapidly the genes that are responsible for a morphological difference.

These examples confirm the importance of cis-regulatory sequences, which are also the basis for evolutionary change between closely related species.

Briefly moving on to Heliocidaris, Paul asserted that Raff no longer considers the various gradations of direct-and-indirect development found among various sea urchin species relevant. But having just looked through several Raff papers from the last few years, I find that he takes care to mention this variability in every case.

Here is why intermediates between direct and indirect development are important, even if they are not found in Heliocidaris (which, after all, only has 2 species): they prove that such intermediate developmental pathways are viable. Paul's version of GE applied to Heliocidaris would require that a gradual pathway from indirect to direct development would not be possible, presumably because the intermediate stages would be lethal. Only then would Paul's "viable macromutations don't occur" argument have any force and make any sense. It's very similar to the "what good is half a wing" argument. In the case of wings, the answer is "look at feathered dromeosaurs and various gliding animals". In the case of "what good is a developmental pathway in between direct and indirect development" the answer is "ask all those sea urchin species that do just this".

If (1) small variations are known to occur ubiquitously, and are viable and hereditable and (2) intermediate stages are known to be selectively viable then (3) macromutations are not required for anything and their existence or nonexistence is irrelevant.

[ 13. February 2003, 03:59: Message edited by: yersinia ]

IP: Logged
yersinia
Member
Member # 324

Icon 1 posted 13. February 2003 04:11      Profile for yersinia     Send New Private Message       Edit/Delete Post 
Here is a pop quiz. Here are two DNA sequences in two species. In species #1, the gene is expressed and codes for a development-related gene. In species #2, the gene is noncoding and is in fact a pseudogene that has accumulated mutations like a stop codon that would mess it up even if it were expressed. The sequence of this pseudogene is completely irrelevant to the life of species #2.

Here are some sections of each sequence, compared. Overall they are 92% similar.

(posting the whole sequence comparison was difficult due to line-length limiations)

code:
catcaaggagaagctctgctacgtcgccct
||||||||||||||||||||||||||| ||
catcaaggagaagctctgctacgtcgctct

---

atcctcctcctccctagagaaaagctacgagct
||||||||||||||| ||||| |||||||||||
atcctcctcctccctcgagaagagctacgagct

---
caacgagagactccgttgttcggagactctctt
||||||| || |||||| |||||||||||| |
caacgagcgattccgttcctcggagactctcct

---

[etc.]

A question for Paul or anyone else: why are these two sequences so similar?

[ 13. February 2003, 04:13: Message edited by: yersinia ]

IP: Logged


All times are East Coast
This topic is comprised of pages:  1  2  3  4  5  6  7  8  10  11  12 
 
Post New Topic  
Topic Closed  Topic Closed
Open Topic    Move Topic    Delete Topic    Top Topic next oldest topic   next newest topic
 - Printer-friendly view of this topic
Hop To:

Contact Us | ISCID

All content © ISCID and content contributor 2001-2003

The ISCID Forums are aimed at generating insight into the nature of complex systems (e.g. biological complexity, organizational complexity, etc.) and the ontological status of purpose, especially from the vantage point of various information- and design-theoretic models.

Indexed by UBB Spider Hack  |  Powered by Infopop Corporation UBB.classicTM 6.3.1.1

PCID | Encyclopedia | Brainstorms | The Archive | News | Essay Contests | Chat Events | Membership