posted 11. February 2003 17:29                    

quote:

---

If many genes gave the same unexpected patterns then we would conclude that something very different than common descent had happened.

---

posted 12. February 2003 06:11                   

quote:

---

Would you agree with this summary of your position?

1. Some biological patterns are consistent with (and best explained by) common descent, because a natural pathway from a common ancestor exists, linking the patterns by descent with modification.

2. Other biological patterns (if observed) would be inconsistent with common descent. These patterns could not have descended in a natural pathway from a common ancestor.

---

quote:

---

Lastly, would you agree that the possibility of discovering patterns in class (2) tests common descent? In other words, it must be at least possible to discover patterns that fall under (2), whether such patterns (data) are observed or not.

---

posted 12. February 2003 06:27                   

quote:

---

Nat Genet 2003 Feb;33(2):138-44

Evolution of gene expression in the Drosophila melanogaster subgroup.

Rifkin SA, Kim J, White KP.

[1] Department of Ecology and Evolutionary Biology, Yale University, PO Box 208106, New Haven, Connecticut 06520-8106, USA. [2] Department of Genetics, Yale University School of Medicine, PO Box 208005, New Haven, Connecticut 06520-8005, USA.

Little is known about broad patterns of variation and evolution of gene expression during any developmental process. Here we investigate variation in genome-wide gene expression among Drosophila simulans, Drosophila yakuba and four strains of Drosophila melanogaster during a major developmental transition -- the start of metamorphosis. Differences in gene activity between these lineages follow a phylogenetic pattern, and 27% of all of the genes in these genomes differ in their developmental gene expression between at least two strains or species. We identify, on a gene-by-gene basis, the evolutionary forces that shape this variation and show that, both within the transcriptional network that controls metamorphosis and across the whole genome, the expression changes of transcription factor genes are relatively stable, whereas those of their downstream targets are more likely to have evolved. Our results demonstrate extensive evolution of developmental gene expression among closely related species.

[...]

Discussion

Phenotypic evolution is both constrained and driven by variation in gene function during development. Because gene expression itself varies, it is an object of evolution in its own right [36]. Determining the proximate causes of this variation—the interactions between trans-regulatory factors and cis-regulatory sequences—will be crucial for understanding how differences in gene function drive the evolution of multigenic traits [37, 38]. In the D. melanogaster subgroup, developmental changes in gene expression vary extensively both within and between species. This variation provides abundant targets for selection and ample fuel for evolution.

Much of the genome-wide variation in expression results from changing developmental constraints, which shift the balance between different evolutionary forces. There are stronger constraints on the activation of gene expression than on the downregulation or degradation of transcripts during development. There are stronger constraints on the expression of genes that encode regulatory molecules than on the expression of genes that encode structural factors or enzymes. There are stronger constraints on genes with small changes in expression during development than on those with larger changes. Because of these constraints, interpreting the biological significance of gene expression variation and evolution will be difficult or impossible outside its developmental context.

[bolds added]

---

In short, the authors studied gene expression during the "major developmental transition" of metamorphesis in Drosophila. Surprisingly (based on what Paul Nelson has been telling us in this thread), they discovered substantial differences in gene expression both between Drosophila species and within species, between strains of Drosophila melanogaster.

Looks like changes in a "major developmental transition" are, after all, known and documented and hereditable to boot. To save his thesis Paul would now have to argue that different strains of Drosophila melanogaster do not share common ancestry. This is, of course, his prerogative.

[ 12. February 2003, 06:29: Message edited by: yersinia ]

posted 12. February 2003 10:24                    

Yersinia,

Thanks for your thoughtful clarifications.

[First, about the Drosophila study. Let's have a fly geneticist put a mix of larvae and healthy adult flies, from the study cited -- including Drosophila melanogaster, Drosophila simulans, and Drosophila yakuba -- into a population cage. You and I will pick out the "major" variants.

All joking aside, development certainly does vary, and much of that variation is heritable. I've never said otherwise. I've got a golden retriever; my neighbor has a little fuzzy white mutt; my other neighbor has a medium-sized yellowish mutt. Their pronounced phenotypic differences have a heritable developmental basis. As Charlie notes above, GE is a quantitative feature of development, and the important question is how much does development vary. Please, try to argue with me, and not a sand-bottom-clown Paul Nelson who is fun to punch with cheap shots.

OK, back to Heliocidaris.]

I'll use your own phrasing:

quote:

---

1. Some biological patterns are consistent with (and best explained by) common descent, because they are what we would expect to see if common descent had actually occurred (and these patterns are what we actually see when we have directly observed common descent occuring).

2. Some biological *features* (if observed) would be inconsistent with common descent. These features could not have originated in a natural pathway from a common ancestor lacking these features.

---

posted 12. February 2003 10:34                    

quote:

---

I have a couple of questions. GE clearly is a quantitative variable. So, while I would agree with you that absolute GE (no significant developmental transitions possible) and common descent are mutually exclusive, anything less than absolute GE is in fact compatible with CD. After all, only so many major body plan changes have occurred throughout the 1 billion years and gazillion organisms-generations chances multicellular life on earth has provided to evolution (and some of those changes may not have been so major after all - see shrimp legs).

---

quote:

---

So, I was wondering what the evidence (not just the theoretical ruminations) for GE is, and whether that evidence points to absolute, or less-than-absolute GE.

---

quote:

---

Second, assuming such evidence for absolute GE exists, I was wondering if it'd also be compatible with less-than-absolute GE.

---

quote:

---

To me, the functionally (not philosophically) axiomatic nature of CD is simply a matter of parsimony. We wouldn't even know where to start to explain the millions of independent pieces of data supporting CD, if CD did not exist (of course, if anybody did come up with a valid alternative, it should be listened to). On the other hand, we can dispense with absolute GE, retain less-than-absolute GE, and still not totally freak out (assuming the evidence is compatible with both, that is).

---

posted 12. February 2003 11:20                    

quote:

---

If GE is a real block for natural mechanisms, why shouldn't we be able to evaluate it using the above tools?

---

We should be able to evaluate it using design tools, but it may then turn out that design and common descent (which postulates the existence of a natural pathway) are going to be pulling in opposite directions.

I'm pretty sure that Yersinia and Charlie D do regard development in Heliocidaris as fully explicable by natural mechanisms, sooner or later. In that respect, their position reflects the mainstream (evolutionary) view of the matter. They would see design explanations as fundamentally at odds with common descent, if the former theories have any empirical content distinct from common descent.

I apologize that my last reply to you was curt. When I think about the theory of common descent, it's as a naturalistic theory, and it's hard for me to get my mind around other approaches (namely, descent + design).

posted 12. February 2003 12:12                   

quote:

---

There's plenty of evidence that is hard, or really impossible, to reconcile with CD, but it's not recognized as such because the grip of CD on the collective biological imagination is so complete.

---

posted 12. February 2003 15:34                    

quote:

---

There's plenty of evidence that is hard, or really impossible, to reconcile with CD, but it's not recognized as such because the grip of CD on the collective biological imagination is so complete.

---

quote:

---

That's just a cheap shot, Paul.

---

posted 13. February 2003 03:53                   

quote:

---

But animals do develop in very different ways, from the earliest stages forward. Thus, if common descent is true [remember that assumption], early development must vary heritably somehow. But how?

Evidence that early developmental stages vary heritably is almost always comparative. That is, an author assumes that two or more groups share a common ancestor (see my comments on Heliocidaris, below); those groups exhibit early embryonic differences; therefore, variation or mutation in early development is heritable.

Consider, for instance, the following passage from Raff and colleagues (1991, 189):

quote:
--------------------------------------------------------------------------------
...early development is often held to be particularly subject to constraint, and thus to be highly conserved in evolution.
--------------------------------------------------------------------------------

There's plenty of experimental support for this, and that support was the main reason classical neo-Darwinism avoided postulating macromutations.

But Raff et al. continue:

quote:
--------------------------------------------------------------------------------
Yet early development does evolve, and sometimes dramatically.
--------------------------------------------------------------------------------

OK -- what's the evidential basis for this claim? Well, it's not experimental. Developing organisms typically respond to early-acting mutations by dying (embryonic lethals).

The evidential basis is the assumption of common descent -- an assumption that here, as elsewhere in historical biology, is not up for grabs.

---

quote:

---

First, about the Drosophila study. Let's have a fly geneticist put a mix of larvae and healthy adult flies, from the study cited -- including Drosophila melanogaster, Drosophila simulans, and Drosophila yakuba -- into a population cage. You and I will pick out the "major" variants.

---

Now, I appreciate the tongue-in-cheek ( ), but why didn't it occur to Paul that perhaps major variations are not necessary, and evolutionary changes in development can occur gradually, by the selection of many small changes!![b] Since when did NeoDarwinism depend on macromutations???

[b]Paul has assumed throughout that major developmental changes must be due to macromutations, but this is not what anyone is arguing!!!

These kinds of variations are found even at the earliest stages of development in Drosophila (biology rule #1: anything you're interested in has been studied the most in Drosophila):

quote:

---

(all bolds added)

Proc Natl Acad Sci U S A 2000 Jan 4;97(1):212-6

Molecular heterochrony in the early development of Drosophila.

free online BTW

Kim J, Kerr JQ, Min GS.

Department of Ecology, Yale University, 165 Prospect Street, New Haven, CT 06511, USA. junhyong.kim@yale.edu

Heterochrony, the relative change of developmental timing, is one of the major modes of macroevolutionary change; it identifies temporally disassociated units of developmental evolution. Here, we report the results of a fine-scale temporal study for the expression of the developmental gene hairy and morphological development in three species of Drosophila, D. melanogaster, D. simulans, and D. pseudoobscura. The results suggest that between and among closely related species, temporal displacement of ontogenetic trajectory is detected even at the earliest stage of development. Overall, D. simulans shows the earliest expression, followed by D. melanogaster, and then by D. pseudoobscura. Setting D. melanogaster as the standard, we find the approximate time to full expression is accelerated by 13 min, 48 s in D. simulans and retarded by 24 min in D. pseudoobscura. Morphologically, again with D. melanogaster setting the standard, initiation of cellularization is faster in D. simulans by 15 min, 42 s; and initiation of morphogenesis is faster in D. simulans by 18 min, 7 s. These results seem to be consistent with the finding that the approximate time to full expression of hairy is accelerated by 13 min, 48 s in D. simulans. On the other hand, the same morphological events are delayed by 5 min, 32 s, and by 11 min, 32 s, respectively, in D. pseudoobscura. These delays are small, compared with the 24-min delay in full expression. The timing changes, in total, seem consistent with continuous phyletic evolution of temporal trajectories. Finally, we speculate that epigenetic interactions of hairy expression timing and cell-cycle timing may have led to morphological differences in the terminal system of the larvae.

[...]

Heterochrony has been most widely studied in terms of morphological evolution, especially with respect to terminal characters (for recent examples, see refs. 31–35). However, Raff (15) has pointed out that heterochrony can be found in earlier as well as in later stages of development. Indeed, changes in developmental timing in the early stages of ontogeny has been described in many studies (6, 36–39). Furthermore, Richardson et al. (40) argue that previous notions of phylotypic stages are based on an incomplete analysis of comparative data, and they suggest that there are no particularly conserved stages of development. In our study, we show that statistically significant developmental timing changes can be detected in the earliest part of the ontogenetic trajectory; hairy is one of the first zygotically expressed genes. Klingenberg (29) notes that modern developmental biology resurrects Haeckel's original meaning of heterochrony (reversals in the order of appearance), compared with the speeding-up or the slowing-down of a particular trajectory. We note that our measurement of heterochrony is a quantitative measurement of the temporal trajectory at the molecular level; it is not merely a measurement of the qualitative sequence of gene expression.

[...]

In summary, we report heterochronic change in the expression trajectory of a developmental gene in the earliest stage of development. The degree of change seems to be consistent with continuous phyletic evolution of temporal trajectories. We speculate that epigenetic interactions of hairy expression timing and cell-cycle timing may have led to morphological differences in the terminal system of the larvae. These results suggest to us that epigenetic interactions of temporal trajectories between molecular cascades can be an important diversifying mechanism at the macroevolutionary level.

---

quote:

---

Nature Reviews Genetics 3, 907 (2002);

EVOLUTION OF DEVELOPMENT IN CLOSELY RELATED SPECIES OF FLIES AND WORMS

Pat Simpson

Link to article

Change over a small evolutionary timescale

If evolution proceeds in small steps, and large changes in gene activity result from several smaller changes at the same locus, then it is important to identify the small changes that might have been individually selected. To do this, a small evolutionary timescale needs to be looked at, by studying closely related species. This approach has the advantage that subtle differences, such as those that might arise from one or a small number of evolutionary steps, can be compared between species. It also allows the design of cross-species functional assays that are likely to be less susceptible to experimental artefacts, which is a concern when comparing species with more-diverged embryonic morphologies. The use of the satellite species of D. melanogaster and C. elegans offers the potential to use the huge amount of genetic information that is available for these model organisms. As for comparisons between distantly related organisms, candidate genes can be selected for analysis. However, in cases where hybrids are viable, empirical genetic analysis can help to identify the underlying variation. Here, I discuss four studies that use either a candidate-gene approach or classical genetics.

Cis-regulatory change at a fly Hox locus. In Drosophila, Ubx is responsible for the morphological difference between the second and third thoracic segments. To achieve this, Ubx regulates many traits through many different targets37. High levels of Ubx at the proximal end of the femur of the second leg of D. melanogaster repress TRICHOME development to give a small hairless patch38. D. virilis, which has no naked patch, has correspondingly lower levels of Ubx. Levels of Ubx in D. simulans are similar to those in D. melanogaster, although D. simulans has a larger naked patch. By exploiting the fact that hybrids between D. simulans and D. melanogaster are viable, Stern showed that the trichome phenotype of hybrids, which result from the activity of a single wild-type Ubx allele, differed depending on which species the allele had come from — the D. melanogaster allele causes a smaller patch than that of D. simulans38. As the proteins from the two species are identical, this variation is presumed to have arisen from differences in the cis-regulatory control of gene expression38.

Change at a nematode Hox locus. This example concerns the gene lin-39, the nematode homologue of Deformed, a Hox gene that is involved in the development of the head in Drosophila39. Free-living nematodes, such as C. elegans, have a defined number of cells and develop from invariant cell lineages40 (Box 1). This simplicity means that various developmental processes can be studied at a cellular resolution that is not possible in most other metazoa and that homologous cells can be recognized between species. Development of the nematode vulva is a well-defined process. Three specific cells, P5.p–P7.p, form the vulva of C. elegans, and are singled out from the 12 ventral epidermal precursor cells by a process of induction (Box 2; for a review, see Ref. 41). The vulva of Pristionchus pacificus — an established satellite species that is separated from C. elegans by 100 Myr — also forms from P5.p–P7.p. However, whereas the vulval fate in C. elegans is induced by a short burst of signal from a specific cell in the gonad, in P. pacificus it occurs in response to a continuous signal from many cells of the somatic gonad42 (Box 2; for a review, see Ref. 43).

In C. elegans, lin-39 is expressed in cells of the vulval equivalence group P3.p–P8.p44, 45 (Box 2). lin-39 is required early to prevent these cells from fusing with the hypodermis and later, during vulval induction, it is upregulated in P5.p–P7.p to specify vulval fates. In P. pacificus, the vulval equivalence group comprises P5.p–P8.p, and lin-39 is only required once — at an early stage — to prevent cell death (Box 2). LIN-39 proteins of C. elegans and P. pacificus are highly conserved in the hexapeptide and homeodomain regions, which are required for DNA binding, but have diverged in other regions46. Nonetheless, when expressed from the C. elegans lin-39 promoter, LIN-39 protein from P. pacificus can rescue lin-39 functions in C. elegans which it does not usually carry out46. This indicates that the difference in function of the LIN-39 protein between species is attributable to the different cellular contexts of the species in which they operate. In turn, this indicates that the differences between the two species reside in regulatory, rather than coding sequence46. Therefore, as in other organisms, changes in the function of nematode Hox genes can underlie evolutionary changes in cell behaviour.

[attention John Bracht for the below section]

Integration of pathways by a newly evolved gene. A study by Kopp and colleagues combines the knowledge of a genetic network in D. melanogaster with the expression patterns of candidate genes in other drosophilid species to uncover the molecular basis for sex-specific differences in fly pigmentation47. In D. melanogaster, the abdominal segments A5 and A6 are strongly pigmented in males but not in females; this is a recently evolved trait48. Mutation of the Hox gene Abdominal-B (AbdB) causes a loss of pigmentation in males, whereas mutations in bric à brac (bab) and doublesex (dsx) lead to a pigmentation of female abdomens. Using transgenic flies, the authors showed that AbdB represses bab in both sexes, but in females this repression is prevented by the female-specific form of dsx, dsxF (Fig. 2). Therefore, the transcription factor that is encoded by bab is only expressed in females where it represses pigmentation. A cross-reacting antibody was used to show that, in the D. melanogaster species group, bab is expressed in females of species with male-specific pigmentation, but not in segments A5 and A6 of males. By contrast, in all MONOMORPHIC SPECIES, Bab is present in both sexes, so its role in antagonizing AbdB function and repressing pigmentation is ancestral. However, because there is evidence that, ancestrally, bab expression was independent of dsxF and AbdB, this gene must have only recently evolved to integrate input from these two distinct genetic pathways47, 48. The authors propose that this is attributable to changes in the cis-regulatory region of bab, and point out that this circuit is flexible and highly evolveable47. The phenotype depends on the levels of bab expression, which, in turn, depends on the balance between the inputs from AbdB and dsx.

Change in a newly identified gene. Hybrids between closely related species of drosophilids can be used to identify the genes that are responsible for small phenotypic differences. The dorsal cuticle of larvae of the melanogaster subgroup of Drosophila has an anterior lawn of fine hairs in all species except D. sechellia49. From interspecific crosses, Sucena and Stern determined that a single X-linked locus was responsible for this trait. By using an overlapping set of X-chromosomal deletions from D. melanogaster and recombination mapping, they were able to map the position of this gene to a small chromosomal interval. This interval contains the D. melanogaster gene ovo/shavenbaby (ovo/svb), which, when mutated, causes a patterned loss of dorsal hairs50, 51. The mutant failed to COMPLEMENT the phenotype of D. sechellia in melanogaster/sechellia hybrids. Different levels of ovo/svb transcripts correlated with the patterns in the two species, indicating that the phenotypic differences between D. sechellia and the other species are caused by changes in the way that their cis-regulatory regions function49. This study illustrates how decades of accumulated knowledge of the genetics of this model organism can be harnessed to identify rapidly the genes that are responsible for a morphological difference.

These examples confirm the importance of cis-regulatory sequences, which are also the basis for evolutionary change between closely related species.

---

posted 13. February 2003 04:11                   

code:

---

catcaaggagaagctctgctacgtcgccct
||||||||||||||||||||||||||| ||
catcaaggagaagctctgctacgtcgctct

---   
          
atcctcctcctccctagagaaaagctacgagct
||||||||||||||| ||||| |||||||||||
atcctcctcctccctcgagaagagctacgagct

---
caacgagagactccgttgttcggagactctctt
||||||| || ||||||  |||||||||||| |
caacgagcgattccgttcctcggagactctcct

---

[etc.]

---