|
Author
|
Topic: The GUToB
|
Pim van Meurs
Member
Member # 541
|
posted 25. April 2003 01:33
Hi Peter
How can you continue to say that these genes did not evolve when I provided several references that show otherwise?
Certainly repetition of erroneous 'facts' is not going to help ones argument.
Btw I do not believe that your argument about the GLO is correct. But once again you have failed to show evidence of NRM in the GLO gene. A frame shift mutation caused most primates to be unable to synthesize vitamin c. If there is a common mechanism for this then I wonder why all these other animals do not suffer from this affliction?
GLO is not used as much to show common descent as much as to show that there used to be a common ancestor which had a working gene.
[quote]
Molecular geneticists who examine DNA sequences from an evolutionary perspective know that large gene deletions are rare, so scientists expected that non-functional mutant GLO gene copies--known as "pseudogenes"--might still be present in primates and guinea pigs as relics of the functional ancestral gene. In contrast, Creationists believe that humans and guinea pigs were each created independently of all other species and must have been "designed" to function without GLO. If this were true, these two species would not be expected to carry a defective copy of the GLO gene. In fact, GLO pseudogenes have been detected in both guinea pigs and humans (Nishikimi et al. J Biol Chem 267: 21967, 1992; Nishikimi et al. J Biol Chem 269:13685, 1994), consistent with the evolutionary view; presumably, related pseudogenes also exist in non-human primates that require dietary vitamin C. The kinds of mutations found in the human and guinea pig pseudogenes are typical of the ones seen in genetic diseases like those mentioned earlier. In this essay I call the human and guinea pig GLO DNA sequences "unitary pseudogenes" to distinguish them from two other kinds of pseudogene occurring in a species that also possesses a functional copy of the same gene (see below). Readers should note that the term "unitary pseudogene" is used here for convenience; there is no standard nomenclature to describe this rare type of pseudogene.[\quote]
The argument is that "The presence of non-functional pseudogene relics is easily explained by the evolutionary model: they are a natural consequence of mutations that fail to be eliminated by natural selection because the function of the gene product has become unnecessary."
Source
For the same reasons you have done so for the 1g5 gene. I would like to see your statistical analysis which shows this. YOu cannot just look at a single nucleotide and know its evolutionary history.
Some hard data please. So far nothing in your model shows that the mutations are non-random and furthermore even if they were, as I have shown, this has no impact on the theory of evolution which takes into account such non random behavior.
So what exactly is your argument? Surely given the rebuttals here I assume that you are dropping the argument that NRM has disproven Neo-Darwinism?
[ 25. April 2003, 02:14: Message edited by: Pim van Meurs ]
IP: Logged
|
|
Rex Kerr
Member
Member # 632
|
posted 25. April 2003 02:08
PB, the underlying mechanism is common descent. The whole point of building trees is it lets you figure out which mutations are shared due to common descent!
I apparently wasn't clear in my statement. I will bold the important part: Be precise. What you think is my strawman is a result of this statement:
quote:
For instance TA (chimp) becomes TG (Orangutan) becomes CG (gibbon) becomes CT (lemur/tamarin).
Now, if a chimp's TA becomes TG in orangutan, doesn't the chimp have to become an orangutan? Otherwise, it isn't TA (chimp) that's doing the becoming, is it? I don't believe you meant to use the word "becomes" there--or maybe you did--but I don't know what you were trying to say, because what you did say had completely insensible consequences.
You still have not shown in detail that NRM1 causes mistakes of assuming common ancestry when there is none. You have claimed it many times, you have referenced papers that don't show that and made a few claims about looking at change of a couple of nucleotides.
However, common ancestry is not determined based on a couple of nucleotides in one gene.
Please show in detail a scenario where a standard method of determining common ancestry fails because of NRM1. Either in a hypothetical example or a real one. You proposed ZFY, but the constructed tree didn't fail.
If you think you have already shown this in detail, please at least cite yourself by date of message post and line or paragraph in the post. I haven't seen anything, and I've been looking for it, but it's still possible that I missed something somewhere. (1g5 is an example of NRM, but I haven't seen any falsely attributed common ancestry because of it.)
As I said before, I can't really say anything about ZFX without a lot more sequences. Maybe the tamarin ZFY, lemur ZFY, and gorilla ZFX all have the ancestral (unmutated) nucleotide at one spot. I don't know--I can't come up with a hypothesis without the sequences, and I'm not going to spend that much time on it until we deal with the issues that are already on the table.
(Also, you are still under the mistaken impression that ZFX hasn't mutated in any primate species in 25 million years. This is false. Look up the paper. If you don't have access to journals, I can figure out a way to get an electronic copy to you.)
Somehow, despite quoting me on the Luria-Delbruck experiment, you didn't address my claim at all! Random loss of resistance and random gain of resistance produce different patterns of resistance over the population. If you think this is not the case, please show in detail a scenario where the two can be mistaken.
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 25. April 2003 02:13
Hi Pim,
Quote:
"How can you continue to say that these genes did not evolve when I provided several references that show otherwise?"
If you have a careful look at the Kim et al paper you will find out that the studied region ZFX doe not show any polymorphism -NOT even on silent position:
Man – 99,7 – Hylobates agilis
Man – 99,7 – Siamang
Man – 99,7 – Orangutan
Man – 99,7 – Gorilla
All primates have exactly the same gene, so I don't understand your statement of "erroneous 'facts' is not going to help ones argument". And if you have a close look at histon H3 we could be a fish or a bird.
Quote: "Btw I do not believe that your argument about the GLO is correct."
I did not discuss the GLO here yet. A careful look demonstrates at least 3 spots that demonstrate similar findings as discussed for the ZFY gene. It tells me that you cannot take this gene as evidence for common descent since you cannot exclude a common mechanism.
quote:
"Or the same reasons you have done so for the 1g5 gene."
The observations andctheir potential implications have been denied for almost a year now on the evc board. Nothing new here. Furthermore, I am not a mathematician, but even if you superficially look at the sequences you see that the nucleotides that mutate are always the same nucleotides. Maybe there is a somebodey around who can do the statistics for this gene.
And for sure such NRM have their impact on evolutionary phylogenetic analysis, since you cannot discriminate between common descent and common mechanism. You assume common descent and the programs/analysis are based on that assumption. Apparently it is NOT common descent but COMMON MECHANISM.
Quote:
Surely given the rebuttals here I assume that you are dropping the argument that NRM has disproven Neo-Darwinism?
In one of your previous mails you said that Cone snail mutations HARDLY falsified NDT. In my opinion "hardly falsify" is not equal to "DO NOT falsify". A falsification does not come in gradations. It is either a falsification or it is not. So, I don't see a reason to withdraw my claim. Furthermore, since NRM line up and give the illusion of common descent this alternative invalidates the strongest molecular argument of common descent.
Best wishes,
Peter
[ 25. April 2003, 02:21: Message edited by: peter borger ]
IP: Logged
|
|
Rex Kerr
Member
Member # 632
|
posted 25. April 2003 02:53
99.7 is not 100. Also, gorilla and tamarin:
code:
Ggo 1 gaccagcaag gcagagaagg ccattgaatg cgatgagtgt gggaagcatt tctctcatgc
Str 1 taccagcaag gcagagaagg ccattgaatg cgatgagtgt gggaagcatt tctctcacgc
x x
Ggo 61 aggggctttg tttactcaca aaatggtgca taaggaaaaa ggagccaaca aaatgcacaa
Str 61 gggggctttg tttactcaca aaatggtgca taaggaaaaa ggagccaaca aaatgcacaa
x
Ggo 121 gtgtaaattc tgtgaatacg agacagctga acaagggtta ttgaatcgcc acctcttggc
Str 121 gtgtaaattc tgtgaatatg agacagctga acaagggcta ttgaatcgcc acctcttggc
x x
Ggo 181 ggtccacagc aagaactttc ctcatatttg tgtggagtgt ggtaagggtt ttcgtcaccc
Str 181 agtccacagc aagaactttc ctcatatttg tgtggagtgt ggtaagggtt ttcgtcaccc
x
Ggo 241 gtcagagctc aaaaagcaca tgagaatcca tactggggag aagccgtacc aatgccagta
Str 241 ctcagagctc aaaaagcaca tgagaatcca taccggggag aagccgtacc aatgtcagta
x x x
Ggo 301 ctgcgaatat aggtctgcag actcttctaa cttgaaaacg catgtcaaaa ctaagcatag
Str 301 ctgcgaatat aggtctgcag actcttctaa cttgaaaacg catgtaaaaa ctaagcatag
x
Ggo 361 taaagagatg ccattcaagt gtgacatttg tcttctg
Str 361 taaagagatg ccattcaagt gtgacatttg tcttctg
There are ten differences. Tamarins and gorillas are both primates.
Please check your facts more carefully.
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 25. April 2003 03:00
Hi Rex,
Here are the hypothetical nucleotide sequences of 7 hypothetical organism living a long time ago. As you can see they all have the same original DNA elements in their multipurpose genome.
code:
000000000111
123456789012
Organism 1 ATCGATGCATGC
Organism 2 ............
Organism 3 ............
Organism 4 ............
Organism 5 ............
Organism 6 ............
Organism 7 ............
The C on position 3 and the T on position 10 are involved in an imperfect hairpin and the probability that C3 and T10 mutate is an order of magnitude higher than the other positions (say 1000:1). (for a real life example see Caporale's book page 38). After a long time of cell divions we get:
code:
000000000111
123456789012 #
Organism 1 ATCGATGCATGC 0
Organism 2 ..T......... 1
Organism 3 .........A.. 1
Organism 4 .....C...A.. 2
Organism 5 ..T...G..A.. 3
Organism 6 ..T......A.. 2
Organism 7 ..T....A.... 2
The hedge (#) is the number of mutations we count today in this stretch of DNA in comparison with organism 1. Your conclusion would probably be that organisms 1, 2 and 3 are most closely related and that organism 5 is most distantly related. In addition, I guess you would conclude that organism 1-3 split of from a common ancestor only recently, while organism 5 split of a long time ago. However, I know that the positions are NRM positions and that almost all mutations are introduced on this position due to a mechanism. It gives a nice illusion of common descent. BTW, the position 6, 7 and 8 are the genuine random mutations. They don't line up, as you can see. This is GUToB.
Best wishes,
Peter
[ 25. April 2003, 03:05: Message edited by: peter borger ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 25. April 2003 03:26
Molecular mechanism of neutral evolution demand about 1% change on neutral positions per 1 My. 0.3 % in 25 My is not quite in accord with that.
Best wishes,
Peter
IP: Logged
|
|
Rex Kerr
Member
Member # 632
|
posted 25. April 2003 05:01
Okay, good, I can see what the effects are.
Here's a possible tree:
code:
------------------------- attgatgcaagc Organism 6 (ancestor?)
|
|----|----------------- ..c......... Organism 3
| |------------ .........t.. Organism 1
| |------------ .....c...... Organism 4
|
|
|---------------------- ......g..... Organism 5
|
|---------------------- .........t.. Organism 2
|------------ .......a.... Organism 7
But one of the methods to tell whether a tree is conclusive or not is to see if there are other trees that fit the data equally well:
code:
------------------------- attgatgcaagc Organism 6 (ancestor?)
|
|----|----------------- ..c......... Organism 3
| |------------ .....c...... Organism 4
|
|
|---------------------- ......g..... Organism 5
|
|---------------------- .........t.. Organism 2
|------------ .......a.... Organism 7
|------------ ..c......... Organism 1
or
------------------------- atcgatgcaagc Organism 3 (ancestor?)
|
|----|----------------- .........t.. Organism 1
| |------------ .....c...... Organism 4
|
|---------------------- ..t......... Organism 6
|------------ ......g..... Organism 5
|------------ .........t.. Organism 2
|-------- .......a.... Organism 7
or
------------------------- attgatgcatgc Organism 2
|
|----|----------------- ..c......... Organism 1
| |------------ .......a.... Organism 7
|
|---------------------- .........a.. Organism 6
|------------ ......g..... Organism 5
|------------ ..c......... Organism 3
|-------- .....c...... Organism 4
All of these require 6 independent mutations, with one overlap, so they're all equally good trees.
So this data doesn't really form a tree well. (Then again, it's a very short sequence.)
Of course, there's no surprise why: the T's and A's don't group into the same clusters. If they had all happened in the same organisms, though, we would have thought we had a more definitive tree.
How likely is it that we'll get a lineup? Since you're not a mathematician, let's just count:
code:
1234567 Species number
tttt...
aaaa... Perfect match (1)
aaa.a..
aaa..a.
aaa...a
aa.aa..
aa.a.a.
aa.a..a One mismatch (12)
a.aaa..
a.aa.a.
a.aa..a
.aaaa..
.aaa.a.
.aaa..a
aa..aa.
aa..a.a
aa...aa
a.a.aa.
a.a.a.a
a.a..aa
a..aaa.
a..aa.a
a..a.aa
.aa.aa. Two mismatches (18)
.aa.a.a
.aa..aa
.a.aaa.
.a.aa.a
.a.a.aa
..aaaa.
..aaa.a
..aa.aa
a...aaa
.a..aaa
..a.aaa One mismatch (4 more)
...aaaa
So, out of the 35 possibilities, only one lines things up properly for a tree. Over half (18/35) give an even split across species, generating poorly-justified trees such as those above. A bit less than half (16/35) give so-so trees.
And for each extra block of mutations you add, it gets less and less likely for a good tree to be constructed.
This method of validating trees is excruciating to do by hand, but is commonplace in the clustering software that is in regular use. Can GUToB explain why trees so often get good validation?
Or, in other words, why do the species who mutate at supposed hotspot #1 *also* mutate at supposed hotspot #2 and #3 and #4 and #5 and #6, in almost exactly the pattern you would expect if the hotspots weren't really hotspots but instead were mutations propagated through common descent?
For for example, if we look at ZFY:
code:
1
1 2 3 4 5 6 7 8 9 0
1234567891023456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
Hsy gaccagcaaggcagagaaggccatcgaatgtgatgagtgtgggaagcatttttctcatgcgggggctttgtttactcacaaaatggtgcacaaggaaaaa
Ptr2 ........................t...................................a.............................t.........
Ggo ........................t...................................a.......................................
Ppy ........................t.................................................................t.........
Hag ....................................................................................................
Mfu ........................t...........................................................................
Cae ........................t...........................................................................
Lca ....................t..............................c.....c..t..............c..............t.........
Str t.......................t..........................c.....c................................t.........
2
1 2 3 4 5 6 7 8 9 0
1234567891023456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
Hsy ggggccaacaaaatgcacaagtgtaaattctgtgaatacgagacagctgaacaggggttattgaatcgccacctcttggccgtccacagcaagaactttc
Ptr2 ......................................t.........................................a...................
Ggo ......................................t.........................................a...................
Ppy .....tg.........................................................................a...................
Hag ....................................................................................................
Mfu ..a..................................................a..........................g...................
Cae ..a..................................................a..........................g...................
Lca ..a...........a..t...................................a........a........t..t..a..t...................
Str ..a..................................................a..........................g..a................
# #
3
1 2 3 4 5 6 7 8 9 0
1234567891023456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
Hsy ctcatatttgtgtggagtgtggtaagggtttccgacacccatcagaactcaaaaagcacatgcgaatccatactggcgagaagccgtaccaatgccagta
Ptr2 .........................a..............g..g.............................c...........a..............
Ggo .........................a..............g..g.............................c...........a..............
Ppy ......................a..a..c...........g..g.............................c...........a..............
Hag .......c.................a..........................................................................
Mfu ..................................t...........g...............a.............g.......................
Cae ..................................t...........g...............a.............g.......................
Lca ................a........a.....t..t...........g.......................c.....g.......................
Str ...............................t..t...........g...............a.............g....................a..
# # #
4
1 2 3 4 5 6 7 8 9 0
1234567891023456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
Hsy ctgtgaatataggtctgcagactcttctaacttgaaaacacatataaaaacaaagcatagtaaagagatgccattcaaatgtgacatttgtcttctg
Ptr2 ..............................................................................g..................
Ggo ..............................................................................g..................
Ppy ..............................................................................g..................
Hag .................................................................................................
Mfu ...c...............................................t..........................g..................
Cae ...c...............................................t..........................g..................
Lca ...c.....c..............a..............g...g.......t..........................g..................
Str ...c...................................g...g.......t..........................g..................
# #
We see that seven times we have the same pattern of one set of nucleotides in every ape and a different set in every non-ape. The evolutionary explanation is that the ancestor of apes had the mutation, and thus all apes got it; and all non-apes didn't separately get the mutation, and thus didn't.
What is the GUToB explanation?
Primates have fairly long lifespans, and mutation rates on the order of 10^-8/generation, so it's actually more like 1% change on neutral positions per 5My. I'm not sure where 0.3%/25My comes from, as 99.7 only goes to gibbon, which as ~15My divergence time; and only about a third of the sites can be presumed neutral, so it's about 1%/15My. Why is it ~3x slower? I don't know. Is it important? I don't know.
But the "molecular mechanism of evolution" doesn't demand any particular rate; on average it's about 10^-8/generation. Of course, there are hot spots and cold spots. That's not in question! What is in question is whether it matters for conclusions of common descent.
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 25. April 2003 12:23
Peter: "In one of your previous mails you said that Cone snail mutations HARDLY falsified NDT. In my opinion "hardly falsify" is not equal to "DO NOT falsify". A falsification does not come in gradations. It is either a falsification or it is not. "
Two problems with that 1) I showed how cone snail mutations seem to NOT falsify neo-Darwinism 2) falsification does come in gradations.
As far as your 100% the same, Rex and others have shown that 99.7 is not 100% and that even among the various primates that were at 99.7% similarity, the sequences were NOT identical. You assert that these mutations were on neutral positions, perhaps time for you to show that for neutral positions the ZFX gene disagrees with common neutral mutation rates.
Let me give you some hints: If the mutations are on positions of weak selection for instance, how would the picture change?
As far as the GLO gene, you raised the issue yourself (posted 24. April 2003 20:05). Your assertion suffers from the same problems in that it lacks a coherent argument why there should be a problem based on some nucleotides being the same in a gene.
The following article may be of interest to you
Cloning and chromosomal mapping of the human nonfunctional gene for L-gulono-gamma-lactone oxidase, the enzyme for L-ascorbic acid biosynthesis missing in man.
Nishikimi M, Fukuyama R, Minoshima S, Shimizu N, Yagi K.
quote:
Man is among the exceptional higher animals that are unable to synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, the enzyme catalyzing the terminal step in L-ascorbic acid biosynthesis. In the present study, we isolated a segment of the nonfunctional L-gulono-gamma-lactone oxidase gene from a human genomic library, and mapped it on chromosome 8p21.1 by spot blot hybridization using flow-sorted human chromosomes and fluorescence in situ hybridization. Sequencing analysis indicated that the isolated segment represented a 3'-part of the gene, where the regions corresponding to exons VII, IX, X, and XII of the rat L-gulono-gamma-lactone oxidase gene remain with probable deletion of the regions corresponding to exons VIII and XI. In the identified exon regions were found various anomalous nucleotide changes, such as deletion and insertion of nucleotide(s) and nonconformance to the GT/AG rule at intron/exon boundaries. When the conceptual amino acid sequences deduced from the four exon sequences were compared with the corresponding rat sequences, there were a large number of nonconservative substitutions and also two stop codons. These findings indicate that the human nonfunctional L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations without selective pressure since it ceased to function during evolution.
I am still awaiting such a coherent argument backed by the necessary statistical analysis of the sequences. As Rex Kerr and others have shown, so far your claims do not seem to be too relevant.
As far as the ZFX numbers you quoted from Here there were some additional information presented
quote:
ZFY showed a good gradual change. The numbers are in percent similarity.
Man 90,9 - Dog
Man 91,4 - Ring-tailed lemur
Man 96,7 Siamang
Man 96,7 Agile gibbon
Man 98,0 Orangutan
Man 99,2 Gorilla
Man 99,5 Chimpanzee
ZFX showed a slower mutation rate than ZFY.
Man 95,7 - Hund
Man 96,7 - Katta
Man 99,7 Hylobates agilis
Man 99,7 Siamang
Man 99,7 Orangutang
Man 99,7 Gorilla
and even a mechanism was proposed
quote:
As far as I can see from the literature, the main reason is theorised to be that the Y linked gene mutates more rapidly because more mutations are produced in males given the continuous production of sperm. I havent seen anything to suggest that the ZFY protein is substantially less effective.
For references see
Lori-Jayne Lawson , Godfrey M. Hewitt
Comparison of Substitution Rates in ZFX and ZFY Introns of Sheep and Goat Related Species Supports the Hypothesis of Male-Biased Mutation Rates
J Mol Evol 2002 Jan;54(1):54-61
Erlandsson R, Wilson JF, Paabo S.
Sex chromosomal transposable element accumulation and male-driven substitutional evolution in humans.
Mol Biol Evol. 2000 May;17(5):804-12.
Shimmin LC, Chang BH, Li WH.
Male-driven evolution of DNA sequences.
Nature. 1993 Apr 22;362(6422):745-7.
[ 26. April 2003, 12:56: Message edited by: Pim van Meurs ]
IP: Logged
|
|
Rex Kerr
Member
Member # 632
|
posted 25. April 2003 17:47
To avoid a does-not does-too scenario with falsifications, maybe it would be useful to consider both empirical and logical falsifications.
A logical or mathematical falsification is either true or not; and thus there either is a falsification or there is not.
An empirical falsification is always subject to errors in data, incompletely understood pathways, improbable events occurring every now and then, and so on. As such, the degree of falsification is determined by the confidence one has in the data and in the consequences of that data for the theory.
IP: Logged
|
|
Mesk
Member
Member # 630
|
posted 27. April 2003 21:38
quote:
peter borger:
Hi Mesk,
I think we must have met in the Powerhouse museum in Sydney last year. If I remember we even spoke about your findings in athlets.
Quite possibly - as I recall, that was the ASMR meeting where the printers had decided to print the background of my poster in an unholy fluorescent pink, for reasons known only to themselves. I would have been the guy standing in front of that glaring monstrosity of a poster trying to look inconspicuous. :-)
But I'm afraid you have my advantage, as I do not recall the conversation - could you remind me of exactly what we discussed?
quote:
What I recall from your poster is that in the population of studies athletes there is also a subpopulation of sprinters that have the double negative genotype (XX) for the ACTN3 gene. This demonstates the redundancy in this subgroup I would say.
Not at all, Peter. True functional redundancy requires that a gene have no function whatsoever. It does not simply mean that an organism can survive with or without the gene, but that an organism without the gene has no selective disadvantage compared to competitors with the gene. Our research has shown that sprinters without a functional ACTN3 gene have a disadvantage compared to sprinters who possess one or two functional copies, and thus that ACTN3 is not redundant. The fact that a small number of sprinters without functional ACTN3 can still compete does not affect this finding - these sprinters obviously have other advantages, either genetic or environmental, that allow them to overcome the disadvantage due to lack of alpha-actinin-3, but this does not mean that the disadvantage does not exist.
Given our results showing that alpha-actinin-3 does have functions in humans, the high frequency of the X (non-functional) allele was initially puzzling. If a gene has even a small function - enough that the loss of the gene confers a negative selective coefficient greater than one over the effective population size, or a reproductive disadvantage of about 0.01% in humans - then it will be conserved by selection, making it difficult to understand how a non-functional allele could have spread for a gene which clearly has a function. However, our results suggest an explanation, namely that the absence of alpha-actinin-3 is advantageous for long-distance performance. Thus the two alleles, functional and non-functional, are being maintained in the population by balancing selection because each has a different selective advantage.
As far as I can see, the evidence for true long-term genetic redundancy - in the sense of genes which have absolutely no function, yet are maintained in the genome over evolutionary time - is entirely unconvincing. Experimental evidence for redundancy using knockout organisms is always suspect, because (as others have already pointed out) it is always possible that the gene only has functions under conditions outside the tested range, or beneath the sensitivity of the experimental technique. The only absolute test for redundancy is to release knockout organisms into the wild and see if they survive and reproduce as effectively as wild-type animals under natural conditions over a significant period of time.
Naturally occurring "knockouts" (as ACTN3 in humans was initially thought to be) do not actually demonstrate long-term maintenance of redundant genes - on the contrary, they indicate that natural selection is capable of removing unnecessary genes from the genome quite efficiently. In the case of ACTN3 there is the added complication of natural selection apparently acting to maintain both functional and non-functional alleles of a gene in the population.
I managed to find some old discussions from another message board in which you put forward your theories on the evolution of the alpha-actinins. As I have an intimate and ongoing research interest in precisely this topic, I was intrigued by your claims that the alpha-actinins in some way contradict modern evolutionary theory. I would be very keen to see a concise summary of these claims, and the presentation of empirical evidence supporting them.
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 27. April 2003 23:54
Before I am going to address the comments on my previous letters, first I will demonstrate additional evidence for NRM in only one species. That is a lot easier to conceive and we don't have to assume interspecies common descent. It pertains the 11 sequences of the human mtDNA region and radiocarbon dated from 62-0 Ky before present (as indicated). The results are very peculiar in that they demonstrate that mutations are non random with resepct to position and nucleotide.
code:
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688 age
83781269984393499198490413479358923448467803911780715672814 # (Ky BP)
Modern human (CRS) ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA - 0
Ancient human (LM3) ....................T.G...........CT.T....T..T......TC....G 10 62
Ancient human (KS8) ....................T.G..............TG.......C............ 5 8-15
Ancient human (KS13) .C............T.....T....C.G.................TC............ 7 8-15
Ancient human (KS16) ....................T...................T.............C..C. 4 9-15
Ancient human (KS1) .C............T.....T.........................CG..T........ 6 10
Ancient human (KS9) .C..................T..............T............C.........G 5 9
Ancient human (KS7) ..............T.....T..................T...........C....... 4 8
Ancient human (LM4) .................T...........G................C............ 3 <10
Ancient human (LM55) ...........G.......................T....................... 2 <10
Ancient human (LM15) ....................T........................T.......C....G 4 0.2
! ! ! ! !! ! !
The sequences have been obtained from ancient human mtDNA in two locations in Australia (kow swamp (abbriviated KS) and Lake Mungo (LM). In my my opinion these data demonstrate NRM as I have indicated by the !-mark.
In addition the data demonstrates that the number of mutaions introduced in mtDNA is much higher than expected from standard theory. In 62 Ky 10 mutations can be observed in LM3 compared to modern refernce sequence, or 7 mutations in just 8-15 Ky. It should also be noted that modern bonobo, modern chimpanzee and Neanderthaler demonstate 29, 24 and 27 mutations in this region. Hypermutations on the same spot does the trick? Over and over on the same spots? My guess would be this is NRM.
Data are from: Adcock et al. Mitochondrial DNA sequences in ancient Australians: implications for modern human origins. Proc. Natl. Acad. Sci USA 2001, 98:537-42.
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 28. April 2003 00:27
Hi Peter,
First of all as I have shown non-randomness wrt location/nucleotide does not invalidate (Neo)-Darwinism, in fact (Neo)-Darwinism all but accepts such processes without much problem.
Also when you claim that "In addition the data demonstrates that the number of mutaions introduced in mtDNA is much higher than expected from standard theory." you seem to be unfamiliar with the fact that standard theory does not predict nor require particular mutation rates.
So if non-random mutations as you have shown are in no way contrary to (Neo)-Darwinian theory then what is the reason for you posting these data? That mutation rates may be non-random? Well, that's no problem for Neo-Darwinian theory.
So what's the deal?
Why not focus on the sequences you have shown us so far and explore if they are relevant to your claims?
IP: Logged
|
|
Rex Kerr
Member
Member # 632
|
posted 28. April 2003 19:14
PB, I'm not sure what the data is supposed to show. Yes, there are mutation hot spots in mitochondrial DNA. How is this relevant to a determination of common descent, or to evolutionary theory?
Also, what is the variability among modern humans in this region? My understanding was that "mitochondrial Eve" was thought to be 200ky old (i.e. all humans alive today share mitochondria from a female who lived 200k years ago). If you are looking at old mutations, you can't take the age of the individuals and divide by the number of mutations to get the mutation rate.
[ 28. April 2003, 19:16: Message edited by: Rex Kerr ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 29. April 2003 21:36
Hi Pim,
quote:
"First of all as I have shown non-randomness wrt location/nucleotide does not invalidate (Neo)-Darwinism, in fact (Neo)-Darwinism all but accepts such processes without much problem."
In my opinion the cone snail's mechanism to generate adaptive toxin genes by a preexisting mechanism invalidates NDT. Of course it can be (and must be) speculated that such adaptive mechanisms evolved through random mutation in conjunction with natural selection. From an evolutionary perspective I cannot imagine that the system was perfect at once, and thus such mechanisms must have evolved from mechanisms that randomly introduced mutations. What puzzles me though is why would organisms evolve a mechanism to randomly introduce mutations while mutations are already random? I can't see a selective constraint for the evolution of such mechanisms. They sounds pretty much redundant to me.
quote:
'you seem to be unfamiliar with the fact that standard theory does not predict nor require particular mutation rates.'
quote:
Erratic overdispersion of three molecular clocks: GPDH, SOD, and XDH.
Rodriguez-Trelles F, Tarrio R, Ayala FJ.
Department of Ecology and Evolutionary Biology, University of California, Irvine, CA 92697-2525, USA. ftrelles@iiag.cesga.es
The neutrality theory predicts that the rate of neutral molecular evolution is constant over time, and thus that there is a molecular clock for timing evolutionary events. It has been observed that the variance of the rate of evolution is generally larger than expected according to the neutrality theory, which has raised the question of how reliable the molecular clock is or, indeed, whether there is a molecular clock at all. We have carried out an extensive investigation of three proteins, glycerol-3-phosphate dehydrogenase (GPDH), superoxide dismutase (SOD), and xanthine dehydrogenase (XDH). We have observed that (i) the three proteins evolve erratically through time and across lineages and (ii) the erratic patterns of acceleration and deceleration differ from locus to locus, so that one locus may evolve faster in one than another lineage, whereas the opposite may be the case for another locus. The observations are inconsistent with the predictions made by various subsidiary hypotheses proposed to account for the overdispersion of the molecular clock.
PMID: 11553790 [PubMed - indexed for MEDLINE]
from:Proc Natl Acad Sci U S A 2001 Sep 25;98(20):11405-10 Related Articles, Links
So, contrary to what you say it is neutral evolutionary theory that predicts here. In my opinion the genes studied are inconsistent with such predictions because the genes are subject to NRM. This is also reflected in the mtDNA. If one studies the mutations in the mtDNA over time in ancient DNAs we observe that the rate of change is not in accord with expectation either. The mutaions rate is much higher than we would have expected. And according to these data human, chimp, bonobo and neandertahler have a common ancestor around 160 Ky before present. Peculiar.
quote:
'So if non-random mutations as you have shown are in no way contrary to (Neo)-Darwinian theory then what is the reason for you posting these data? That mutation rates may be non-random? Well, that's no problem for Neo-Darwinian theory. So what's the deal?'
In my opinion, the NRM demonstrated for the 1g5 gene is due to a mechanism similar to the mechanism observed for the conesnail toxins. Why else would the mutation be exactly on the same spot in this gene? Since the 1g5 gene is likely involved in parasitic defence (evolutionary armsrace) it is adaptive to the environment. I think that is suffice to question the validity of NDT.
quote:
'Why not focus on the sequences you have shown us so far and explore if they are relevant to your claims?'
In my opinion NRM is highly underestimated and I also think that due to a common mechanisms shared by organism having the same/similar multipurpose genome it is fairly impossable to discriminate between common descent and common mechanisms.
Best wishes,
Peter
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 29. April 2003 23:47
Dear Peter,
While you may still consider the cone snail to be an example of invalidating NDT, it is clear from my references that the cone snail toxines have undergone selection. In fact the answer to your question "what is the selective advantage of being able to increase mutations" is actually quite straightforward, in a situation of predator prey, increased variation helps one to 'outrun' or 'keep up with' one's predator/prey. Another great example is of snails and parasites. In lakes with lots of parasites the snails tend to reproduce sexually, at a higher cost but with the added benefit of introducing more variation. So despite your objections it seems clear that the ability to increase mutational pressure can be quite advantageous.
When I pointed out that there are no requirements for the rates of evolution you contribute an article which, while interesting, contributes little to my argument. The article merely shows that mutational rates did not remain constant but of course the three genes were not expected to evolve at identical rates. In fact another of your problems is that you look at neutral evolution and it is not clear that the mutations that we looked at fall into that category. In any case, that mutation rates were presumed to be constant does not mean that they are equal or that the neutral theory predict a particular mutation rate. All it predict is that whatever rate it is, it stays constant in time. But in the end the paper you cite seems to contradict your usage of any particular evolutionary rate as being required. There are some interesting tables in the paper.
Similarly your claims about the cone snail and 1g5 gene state that in _your opinion_ similar mechanisms are at work, but fail to describe any such mechanisms. But in making this claim you make another somewhat fundamental error namely by claiming that since the 1g5 gene is involved in parasitic defense (at least according to you) it is therefor adaptive to the environment. Perhaps a better argument would have been that assuming that the gene was relevant to parasitic defence that selective pressures of the environment selected for particular mutations in the gene.
Your claim that it is fairly impossable to discriminate between common descent and common mechanisms has been questioned by several people now who suggested that some solid examples would help us establish the value of your claims. Repeating them without such efforts to provide for a reasoned argument why makes it really hard to evaluate your claims.
So a suggestion or two: 1. provide us with this common mechanism even wild guesses 2. provide us with an example which shows your claims about common descent and common mechanisms.
Best Wishes
P.
P.S. Check out this paper Proc. Natl. Acad. Sci. USA Vol. 96, pp. 97169720, August 1999
Evolution Neutral evolution of mutational robustness
by ERIK VAN NIMWEGEN*, JAMES P. CRUTCHFIELD*, AND MARTIJN HUYNEN
[ 30. April 2003, 00:01: Message edited by: Pim van Meurs ]
IP: Logged
|
|
|
Printer-friendly view of this topic