|
Author
|
Topic: The GUToB
|
peter borger
Member
Member # 722
|
posted 26. June 2003 01:58
Hi rex,
Here we have a real life model. It pertains a real sequence in several old world monkey (data from Dr Page, the primatologist).
code:
77777777777777777777777777777777777777778888888888888888888888888888888888888888888888888888888888888888888888
66666666667777777777888888888899999999990000000000111111111122222222223333333333444444444455555555556666666666
01234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789
Hsa TC-AC-?TTATTATTATGTGAGTAACTGGA-AGATACTGATAAGTTGACAAATCTTTTTCTTTCCTTTCTTATTCAACTTTTATTTTAACTTCCAAAGAA-CAAGTGCAA
Ptr ..-..-?.......................-.....................................................................-.........
Ggo ..-..-?.......................-.....................................................................-.........
Ppy ..-..-?.......................-...........T...............-.........................................-.........
Hla ..-..-?C..................C...-...........T.......G..............C..................................-.........
Mmu ..-..-?..............A........-...........T.........................T...................G...........-.........
Mne ??????????????????????????????????????????????....C.......G.......C.T...............................-.........
Mni ?????????????????....A........-...........T.........................T...............................-.........
Lat ?????-?............T.A........-..........CT.........................T.......................G.......-?????????
Pcy ..-..-?.....G........A........-...........T.......G.................T...............................-?????????
Tge ..-C.-?.....G........A........-...........T.........................T...............................-?????????
Msp ..-..-?..............A........-...........T........................GT...............................-.........
Mle ..-..-?..............A........-...........T.........................T...............................-.........
Cga ..-..-?..............A........-.........C.T.........................T...............................-.........
Cce ..-C.-?............-.A........-...........T.........C...............T...............................-.........
Cae ?????????............A........-...........T.........................T...............................-.........
Cpo ..-..-?..............A........-...C.......T.C........T..............T...............................-.........
Cgu ?????????????????????????.....-...C.......T.C........T..............T...............................-.........
Nla ..-???C.....G........A..-.....-...G.-.....T.C........T..............T...............................-.........
Tob ?????????????????????????.....-...C.......T.C........T..............T......T................T.......-.........
At first sight it looks like a nice gradual evolutionary model demonstrating a the inheritance of acquired mutations (I do not say that mutations cannot be inherited, I say that such data are not perse evidence for common descent. Rather they could provide evidence for MPG and NRM. The abbreviations: HSa (Homo sapiens); Ptr (Pan troglodytes, chimp); Ppa (Pan paniscus, bonobo); Ggo (Gorilla gorilla); Ppy (Pongo pygmaeus, orangutan); Hla (Hylobates lar); Mmu (Macaca mulatta); Mne (M. nemestrina); Mni (M. sp); Lat (Papio atterimus); Pcy (P. hamadryas cynocephalus); Tge (P. gelada); Msp (?); Mle (Cercocebus leucophaeus, mandril); Cga (Cercocebus galeritus); Cce (Cercopithecus cephus); Cae (Chlorocebus aethiops); Cpo (?); Cgu (Colobus guereza); Nla (Nasalis larvatus); Tob (Trachypithecus obscurus).
But lets have another look at the data from a different angle. For instance from the stance of the mandril (Mle):
code:
0123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345
Mle TCAC?TTATTATTATGTGAATAACTGGAAGATACTGATATGTTGACAAATCTTTTTCTTTCCTTTTTTATTCAACTTTTATTTTAGCTTCCAAAGAACAAGTGCAA
Hsa ....?..............G...................A.........................C........................................
Ptr ....?..............G...................A.........................C.......................................
Ggo ....?..............G...................A.........................C........................................
Ppy ....?..............G...................................-.........C........................................
Hla ....?C.............G....C......................G..............C..C.......................................
-
-
-
MmU ....?................................................................................G....................
Mne ???????????????????????????????????????????....C.......G.......C..........................................
Mni ???????????????...........................................................................................
Lat ?????............T....................C..................................................G.......?????????
Pcy ....?.....G....................................G.................................................?????????
Tge ..C.?.....G......................................................................................?????????
Msp ....?...........................................................G.........................................
Cga ....?................................C....................................................................
Cce ..C.?............-...............................C........................................................
Cae ???????...................................................................................................
-
-
-
Cpo ....?..........................C.........C........T.......................................................
Cgu ???????????????????????........C.........C........T.......................................................
Nla ..??C.....G...........-........G.-.......C........T.......................................................
Tob ???????????????????????........C.........C........T.....................T................T................
We see a completely different picture and we are able to identify the MPGs and the NRM. It should be clear that human, chimp, gorilla and orang are derived from the same MPG. But we knew that already from literature. The differences are merely due to non-random shuffling.
From Mmu-Cae we do not identify common descent at all, (at least it cannot be not identified through shared mutations). I propose that they originally all had the same gene that is subject to NRM in conjunction with random mutation. It is also clear that Cpo to Tob could share an MPG, although the positions can also be attributed to NRM (obvious for 794).
It is also not unimportant to note that these data are all obtained from individual species. So, the positions that vary naturally in this sequences are UNKNOWN.
How about that?
best wishes,
Peter
IP: Logged
|
|
Mesk
Member
Member # 630
|
posted 26. June 2003 03:48
Peter,
Don't act all shocked - your claim that phylogenetic trees were essentially random, and that only consistent ones were selected for publication, clearly implies that biologists are engaging in widespread "conspiracy and deception". However, you seem to be unwilling (or unable) to substantiate this claim, even though I have suggested one relatively straightforward way to demonstrate its accuracy. You also seem to be blissfully unaware that in accepting that NRMs would generate random phylogenies, you are blatantly contradicting your earlier claims that NRMs can create "the illusion of common descent". Now, Peter, why should I (or anyone else) accept an idea which is (a) entirely unsupported by hard evidence, and (b) contains significant numbers of internal contradictions?
Your above post to Rex perfectly illustrates the problems with the "evidence" you claim supports your theories. You provide a multiple alignment of sequence data (from some unspecified chromosomal region) apparently obtained from several different primate species. You then rearrange the sequences into a different order and group them into three categories. Without any further explanation you claim that the clear clustering of humans, chimps, gorillas and orangutans into a single group is due to their sharing of an "MPG" - and yet this arrangement is of course also perfectly compatible with the hypothesis of common descent, and appears to agree nicely with most other published phylogenies of primates (contrary to your earlier claim that phylogenies were essentially random). You give no detailed explanation of how you go about identifying "MPGs" and "NRM" - these are simply asserted. This is not a scientific approach, Peter.
If I were to test the hypothesis of common descent using these data, I could assess the sequences using a variety of independent analysis tools and attain some measure of statistical confidence in the outcome. I could compare the phylogenies generated from these data with those obtained from other studies, and determine whether they were consistent (as would be predicted under common descent). I could even (as Rex did so eloquently for the ZFY gene earlier in this thread) take some subset of the sequence, use it to generate a phylogenetic tree, and then see if that agreed with phylogenies determined using other subsets. In other words, I could employ well-validated analysis tools to generate objective statistical measures in the testing of my hypothesis.
And what do you offer in comparison, Peter? The assertion that the data demonstrate NRM. No objective method, no statistical analysis, no validation of the outcome - simply the subjective claim that your hypothesis is correct. Why should we pay any attention to this?
Extraordinary claims demand extraordinary evidence, and so far your proffered evidence has been far from extraordinary. You appear to expect us to simply take you at your word, without a shred of objective, empirical data to back up your claims. Is this really a reasonable expectation, Peter?
If you want anyone to take your claims of NRM seriously, you need to (in the words of my high-school maths teacher) show your working. Don't simply assert that NRM is illustrated in the sequence data - demonstrate it. Describe to us in detail the process you go through to determine NRMs and MPGs, so we can evaluate it for ourselves.
I look forward to your response.
Mesk.
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 26. June 2003 05:51
Hi Mesk,
If you were to test the hypothesis of common descent using these data, you could assess the sequences using a variety of independent analysis tools and attain some measure of statistical confidence in the outcome. You could compare the phylogenies generated from these data with those obtained from other studies, and determine whether they were consistent (as would be predicted under common descent). You could even (as Rex did so eloquently for the ZFY gene earlier in this thread) take some subset of the sequence, use it to generate a phylogenetic tree, and then see if that agreed with phylogenies determined using other subsets. In other words, you could employ well-validated analysis tools to generate objective statistical measures in the testing of my hypothesis.
And your conclusion would be?
Common descent? Common design? Common mechanism?
If you tell me how we can discriminate between these, be my guest. We certainly cannot if we start with the axioma "evolution did it".
Best wishes,
Peter
IP: Logged
|
|
Mesk
Member
Member # 630
|
posted 26. June 2003 22:17
Peter,
Common descent is an observed phenomenon which explains patterns of genetic relatedness. If I were to go to my next family barbecue and obtain blood from all of my relatives, I could use genetic markers to construct a family tree which precisely matched the actual pattern of relatedness between us. The same thing can be done for more distantly related inbred mouse strains with known patterns of relatedness, with precisely the same result. The logic of phylogenetic analysis - using patterns of sequence similarity to determine patterns of evolutionary relatedness - has thus been validated using known relationships. We know from such straightforward studies that degree of genetic similarity indicates degree of genetic relatedness, and this can be applied in a very straightforward manner to patterns of genetic similarity amongst higher taxa indicating patterns of common descent.
What is the logic of determining NRM, Peter? Do you have an example in which known NRMs have resulted in the generation of a relatedness tree which gives a false impression of common descent? Do you have a worked-through example in which NRMs in hypothetical organisms could produce a false, but consistent, phylogenetic tree? (Rex has shown that your earlier hypothetical example actually produced an ambiguous phylogeny, which is not what we see in most phylogenetic trees in real organisms.) No, and no. You have absolutely no theoretical model for how NRMs could produce the false impression of common descent, yet you continue to assert that this is the case.
But there is a more important question here, which I have asked on several previous occasions but you have persistently avoided: if (as you claim) NRMs generate the false impression of common descent, then how can you claim to be able to detect them from comparative sequence data? You state outright that Dr Page's primate data illustrate NRM - but how could you possibly know this if NRMs produce patterns which cannot be distinguished from common descent?
And if (as you appear to be claiming in a spectacular display of self-contradiction) NRMs can be detected from comparative sequence data simply by searching for phylogenetically incongruous sites, then isn't it blatantly obvious that the fact that most sites are phylogenetically congruent means that NRMs do not contribute in any significant way to the pattern of sequence similarity between different organisms?
Once again, Peter, why should we take a theory so completely riddled with self-contradictions and so lacking in empirical evidence seriously? Why should we even care about NRMs, given that you cannot provide any evidence - or even any vague theoretical basis - for your claims that they might interfere with phylogenetic analysis?
Is any of this getting through, Peter? It simply is not good enough to keep on repeating the same assertions. You have a theory which is almost entirely undefined and provides no valid objective statistical test, what little you do tell us is utterly self-contradictory, and you can provide no solid evidence for your claims. For a layperson this might be an acceptable way of thinking, but you're supposed to be a scientist! Peter, for the last time, where is the science?
Mesk.
IP: Logged
|
|
Rex Kerr
Member
Member # 632
|
posted 26. June 2003 22:31
The conclusion would be common descent, for ZFY. We expect, as a first approximation:
Common mechanism: hotspots are biased for changes from one thing to another. If we split the list of species in half, we should pick up the same hotspots from each half. There is no reason to expect correlation between two halves of the gene.
Common design: Anything goes.
Common descent: mutations are inherited, so if we split the gene in half and construct an ancestral tree, the two halves of the gene should agree.
We observed that the two halves of the tree more or less agree (given the small number of mutation s to work from), and conclude common descent.
Your example above also seems to be one of common descent, as Mesk points out. There are further commonalities that are suggestive that you have overlooked: Hsa, Ptr, and Ggo all share an A at position 39. Is this common mechanism or common descent? We can't tell--but we could if we looked at many other genes and found that they also had this pattern of sharing mutations in Hsa, Ptr, and Ggo.
Likewise with Pcy and Tge at position 10. And Cpo, Cgu, Tob at position 31.
Lat, Pcy, Tge share a row of question-marks at the end; is this a shared deletion? Likewise with Cgu and Tob?
Of course, it is difficult to determine common descent if you don't have enough data. A finding of "I don't see common descent here" is only interesting if you also have the result, "I *ought* to find common descent here, if it exists, given the statistics of the data".
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 26. June 2003 23:55
Peter: And your conclusion would be? Common descent? Common design? Common mechanism?
Common descent most likely. As Rex Kerr has shown your data do support common descent. Your suggestion(s) which vary from 1) phylogenies are random or 2) NRM could give false evidence of common descent both seem to fail on some pretty fundamental grounds namely 1) lack of supporting evidence beyond your copying a small part of a genome without any supporting statistical analysis 2) the fact that phylogenies are mostly quite congruent.
I find it hard to understand how you jump from your examples to your conclusions when no effort is made to actually analyze the data.
IP: Logged
|
|
gordon
Member
Member # 781
|
posted 27. June 2003 12:07
Rex,
Of course you are correct on tree numbers - my Nei and Kumar book was on the shelf behind me and I was too lazy to double-check.
Of course, 105 is still far more than the 2, maybe three different arrangmenets one gets, depending on the locus and amount of data, when looking at a 5 species analysis.
According to Borger's newest proclamation, GUToB indicates that an analysis of 5 species should, in fact, produce somewhere in the neighborhood of that 105 upper limit.
That is not the case, so Borger relies on his conspiracy claim.
IP: Logged
|
|
gordon
Member
Member # 781
|
posted 27. June 2003 12:19
Dr.Davison,
I have no current paleontological sources to quote, but as you seem to rely upon such sources, and are apparently still active in promoting your ideas, it seems logical that you would try to utilize current thought in the field. That you choose not to is up to you.
You may very well "believe" that a new species starts out as an individual, and you may cite evidence that some frogs can "produce both sexes", whatever that is supposed to mean. But is the offspring of this frog a new species? Does the offspring reproduce asexually, creating a population of clones, until suddenly they start inbreeding sexually?
Where is the experimental evidence for that?
I find it odd, though, that you on the one hand seem to prefer the musings of paleontologists - most of whom it seems died decades ago - over the actual paleontological evidence. For, last I knew, there is a clear indication that following large scale extinctin events, there are large scale radiation events, swhich is in direct contrast to your claim of evolution stopping. At different times for different species.
And please forgive me, Dr.Davison, but repeating your beliefs over and over does not give them any more strength.
I am at a loss as to why the manifesto was linked to on this forum in the first place. The 'first timer' link brings you to a page on which we find:
"All critiques at Brainstorms must be in the spirit of helping to improve the hypothesis."
Several have pointed out flaws in the hypothesis, including contradictions between your cited authorities and your hypothesis, but you seem firmly entrenched in your viewpoint. Thus, there seems to be no way to improve the hypothesis when there is a steadfast refusal to address its shortcomings. Also on the linked to page, there is a part in which it says that efforts only to shoot down the hypothesis will be quashed, basically, and basically if you can't say something nice, once in a while at least, don't say anything at all. That seems anathema to the purpose of a brainstorm - especially when the brainstorms pretend to relate to legitimate science.
If the hypothesis is weak, then it is weak, and no amount of internet back-patting will change that.
So please address the criticisms pointed out rather than relying on restating your position over and over.
IP: Logged
|
|
gordon
Member
Member # 781
|
posted 27. June 2003 12:47
quote:
Peter:
Morover, Gordon, how can I refer to sequences not appearing in literature?
Then what is the basis for your claim that descent unfriendly analyses don’t make it into the literature? As you readily admit they are not in the literature, how is it that you know that they exist? I have already explained that I am familiar with and have done phylogenetic analyses, and I have never seen what you claim. If you cannot provide any evidence or documentation for this claim, and it is a serious one, then perhaps it would be best to stop making it until you do actually have some support for it. Otherwise, you just make yourself look like a conspiracy monger. quote:
If you do a search for Roderick Page, you will find the literature on reconsiliation of gene trees with species trees. I think it is his specialty.
According to his home page:
“My research interests include systematics, molecular evolution, bioinformatics, software development, host-parasite cospeciation, genomics, and - I'm really trying to forget this – lice.”
As I know that English is not your first language, I can understand the difficulty you seem to have with this. It seems that you do not understand what the reconciliation is that Page’s group refers to. From the abstracts of two of his papers:
Vertebrate phylogenomics: reconciled trees and gene duplications.
Page RD, Cotton JA.
Division of Environmental and Evolutionary Biology, IBLS, Graham Kerr Building, University of Glasgow, Glasgow G12 8QQ, UK. r.page@bio.gla.ac.uk
Ancient gene duplication events have left many traces in vertebrate genomes. Reconciled trees represent the differences between gene family trees and the species phylogeny those genes are sampled from, allowing us to both infer gene duplication events and estimate a species phylogeny from a sample of gene families. We show that analysis of 118 gene families yields a phylogeny of vertebrates largely in agreement with other data. We formulate the problem of locating episodes of gene duplication as a set cover problem: given a species tree in which each node has a set of gene duplications associated with it, the smallest set of species nodes whose union includes all gene duplications specifies the locations of gene duplication episodes. By generating a unique mapping from this cover set we can determine the minimal number of such episodes at each location. When applied to our data, this method reveals a complex history of gene duplications in vertebrate evolution that does not conform to the "2R" hypothesis.
Proc R Soc Lond B Biol Sci. 2002 Aug 7;269(1500):1555-61
Going nuclear: gene family evolution and vertebrate phylogeny reconciled.
Cotton JA, Page RD.
Division of Environmental and Evolutionary Biology, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G12 8QQ, UK. j.cotton@udcf.gla.ac.uk
Gene duplications have been common throughout vertebrate evolution, introducing paralogy and so complicating phylogenetic inference from nuclear genes. Reconciled trees are one method capable of dealing with paralogy, using the relationship between a gene phylogeny and the phylogeny of the organisms containing those genes to identify gene duplication events. This allows us to infer phylogenies from gene families containing both orthologous and paralogous copies. Vertebrate phylogeny is well understood from morphological and palaeontological data, but studies using mitochondrial sequence data have failed to reproduce this classical view. Reconciled tree analysis of a database of 118 vertebrate gene families supports a largely classical vertebrate phylogeny.
So, rather than some additional layer of ‘conspiracy’ to prop up evolutionary ideas, the reconciliation of gene and species trees is a tool to help identify gene duplications and overcome their impact on phylogenetic studies in which duplicated genes are used.
So, again, I fail to see the relevance of this.
I have read those posts (on supposed redundancies) and the responses to them here and elsewhere and it seems that the only person that sees them as evidence for MPG is you, I’m sorry to say. quote:
Gordon, you summarise the whole point here:
"As for the localization of substitutions to various mutation-prone regions in plasmids, I fail to see what this has to do with confounding phylogenetic analysis, causing trouble for evolution, or supporting NRM in any way. Substitutions are more likely to occur in certain loci. Pardon the expression, but big deal. The paper you cite deals with only a 210 bp segment of the gene with known ‘hot spots.’"
KNOWN hotspots. The other shared mutaions can also be hotspots. It is UNKNOWN. The whole phylogenetics is based on the asssumption that mutations are random. But they are not. You didn't exclude NRM either, did you? To exclude NRM in homolgous genes requires a tremendous amount of sequencing both inter and intraspecies. The refernces I cited demonstrate that meta analysis of sequences reveal NRM.
In reality, phylogenetics is premised on the demonstrated tendency of mutations to be passed on to offspring and that over time, the patterns produced by these lineage-specific mutations are indicative of descent. There are several papers freely available in the literature showing this experimentally. It appears that NRM did not confound any of these experimental analyses. Unless of course the results that did not conform to the pre-conceived notions of the investigators were suppressed…
:roll eyes:
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 29. June 2003 23:49
Hi Mesk,
Thanks for your response, although I still await your response to my specific (and very interesting) questions wrt the ACTN genes.
Anyway, you say that "common descent is an observed phenomenon which explains patterns of genetic relatedness." I presume you mean that it is a phenomenon observed within reproducing species? We have never observed chimp mating man, did you? Besides, a recent analysis demonstrated that only approx 50% of chimp and human DNA is able to hybridize. And only a minor 5% of the Y chromosome matches. That is very rapid acquisition and/or divergence of DNA sequences, isn't it?
Probably it is NON random. Besides it neatly demonstrates that being human or ape is most likely NOT determined by protein coding DNA elements. (reference in Science 295:131-134).
Furthermore, I wish you a nice time with your family barbeque. Be careful with such family analysis: Sometimes you discover things you rather not wanted to know (your brother is only your half-brother. Or your dad is not your dad, something like that). However, it should be clear that -and I mentioned that before- that I do NOT dispute genetic inheritance of mutations. I claimed that shared mutation do NOT proof common descent, since they may line up independently. I refered to the lamin gene and to your ACTN (which could probably demonstrate NRM in one (or both) of the exons).
And regarding the mouse strains, what exactly do they show? That immunogenes and jumping DNA elements (retroviruses) do not yield the known phylogeny. But of course you can follow the (point)mutations in these lines. But that's not in dispute. What is in dispute is whether the common mutations in chimp and man are due to common mechanism or common descent (thus INTRAspecies comparisons, not INTERspecies comparisons).
All you do is extrapolating from observed INTERSPECIES observations. Since we see something in mouse you immediately say that "since we do this observation it must also be valid for interspecies comparisons". I say, probably that is nothing but an assumption. If not, maybe you could give some scientific proof for that. Anyway, the low degree of shared mutations in protein coding DNA sequences between chimp and human (1 per 100 or so) may be easily explained by NRM.
You ask me "What is the logic of determining NRM, Peter? Do you have an example in which known NRMs have resulted in the generation of a relatedness tree which gives a false impression of common descent?".
Did you read my previous mails on the 1g5 gene? I already commented on this genes that if you miss a couple of sequences you will make wrong conlusions wrt common descent (even intraspecific). For instance, you would probably conclude that the flies in Italy, USA III and Peru have a common ancestor (based on the shared mutations) but most likely they don't. As discussed.
Furthermore, you say that "I (=peter) have absolutely no theoretical model for how NRMs could produce the false impression of common descent, yet you continue to assert that this is the case."
And I will keep asserting this as long as you guys don't understand what I mean. For once, put off the evo-glasses and listen. If the position and nature of mutations is subject to the DNA sequence (and there is increasing evidence for this view) than in similar sequences they might line up. Whether you cut a gene in half or in three part doesn't matter at all, since the DNA elements or gene-parts you are comparing are similar anyway. So from GUToB it is expected that the will more or less give the same results. That is common mechanism or common descent? In conlusion: we CANNOT discriminate between common mechanism and common descent.
You ask me "if NRMs generate the false impression of common descent, then how can you claim to be able to detect them from comparative sequence data?" I infer them from positions in the same sequence that do not follow GUToB's rule strictly(this rule holds that 'shared mutaions are due to shared biochemistry and same original DNA sequences'). GUToB 2.3.5a holds that "Alignment of mutations between species that currenly do not interbreed is not pure." This is because of the variability within species. None of the individuals is the same (due to translocating and recombination of DNA elements). If a preexisting mechanism or random mutation (I don't deny RM, of course, since they are real) changed the DNA sequence this will definitively have its effects on the microenvironment of the DNA sequence (DNA folding, structure, binding of proteins, etcetera, slightly disturbing the balances) of the DNA and may result in this effect. I could take such positions as evidence for NRM. Ultimately, it all depends on the algorithms you apply to such DNA sequences would be my guess. Maybe we need some new programs to analyse the DNA sequences.
Mesk, you should know that all new hypotheses (they only become theories when proven) start like this and new evidence will proof the hype to be false or valid. If nobody is paying attention to falsifications of current theories and avoid new hypotheses than we will probably never know what is realy going on, and it will stay a matter of believe.
I know it simply is not good enough to keep on repeating the same assertions, but simply denying what I propose is also not the scientific way to go. As soon as I know how to discriminate between common descent and common mechanism I will subject a number of suspect DNA sequences to an objective statistical test.
Finally you talk about claims without evidence. I have a heard the claim of evolution (microbe to man) for a long time now and I have not seen any evidence. If you think evolution is population genetics I have to disappoint you, since it is not. Population genetics is about the frequencies of preexisting alleles in a preexisting population. Evolution is about microbe to man. Quite a difference.
"For a layperson this might be an acceptable way of thinking, but you're supposed to be a scientist! Peter, for the last time, where is the science?"
What happened to objective science anyway?
best wishes,
Peter
IP: Logged
|
|
Pim van Meurs
Member
Member # 541
|
posted 29. June 2003 23:52
Peter asserts
quote:
You ask me "What is the logic of determining NRM, Peter? Do you have an example in which known NRMs have resulted in the generation of a relatedness tree which gives a false impression of common descent?".
Did you read my previous mails on the 1g5 gene? I already commented on this genes that if you miss a couple of sequences you will make wrong conlusions wrt common descent (even intraspecific). For instance, you would probably conclude that the flies in Italy, USA III and Peru have a common ancestor (based on the shared mutations) but most likely they don't. As discussed.
Please could Peter provide us with the statistical analysis of the data which would lead to wrong conclusions wrt common descent.
Details Peter, details. Your assertions, while interesting lack in detail, foundation in solid statistical analysis and in fact I would argue, supporting evidence.
Your extraordinary claims surely could benefit from a common phylogenetic analysis supporting your claims.
Can we expect such?
Peter also claims
quote:
And exactly these spots will give the impression of common descent. Isn't that obvious?
Still lacking any foundation in analysis Peter. Isn't that obvious?
[ 30. June 2003, 00:34: Message edited by: Pim van Meurs ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 30. June 2003 00:14
Hi Gordon,
In response to your mail of june 25:
You say that you fail to see what this [the localization of substitutions to various mutation-prone regions in plasmids] has to do with confounding phylogenetic analysis, causing trouble for evolution, or supporting NRM in any way.
It should be obvious from these data that it is dependent on the DNA sequence and topogy where the mutaions are introduced. If the plasmid is not integrated the percentages of NRM significanty differed compared to the intregrated plasmid.
What about the rest of the plasmid?
= stable.
What about the nucleoid DNA?
Don't know. NRM?
That specific regions, again, are prone to acquiring substitutions, it strains credulity to consider this as anti-”Darwinian” evidence of support for what amounts to front-loading.
And exactly these spots will give the impression of common descent. Isn't that obvious?
Best wishes,
Peter
IP: Logged
|
|
nosivad
Member
Member # 767
|
posted 30. June 2003 08:15
Gordon, I just happened on your response to me. Why are you responding on this thread? Why not respond on the thread I posted? I have better things to do than search all of brainstorms to retrieve what you or others have to say about the subject of another thread. Please stick to the subject. Thank you. nosivad
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 01. July 2003 02:11
hi Pim (plus others)
You say:
"Your extraordinary claims surely could benefit from a common phylogenetic analysis supporting your claims"
First and foremost --and as mentioned before-- the evolutionary claims from microbe to man is far more extraordinary than my claim that mutations line up due to common mechanisms, i.e. same DNA sequence plus same biochemistry yields similar mutations with respect to position and nucleotide. If you don't agree please explain why you think so.
In other words, it is not me who has to provide the extraordinary evidence. I already provided you with ordinary evidence. Now it is up to the evolutinary community to rebunk my claims and PROOF that microbe to man evolution through accumulation of utter random mutations and selection is real. This is THE utmost extraordinary claim I have ever heard in my entire life and I have never seen any evidence that unequivocally supports this assertion. So, let's not turn the world up-side-down. As long as your hypothesis has not been confirmed it is a hypothesis and in my opinion it's not even a good one. So, as long as you cannot provide unequivocal evidence for evolutionists' assertion it is not much more than a 19th century unproven hypothesis. Anyway, if you have the evidence be my guest and show it. I will have an objective look at it and decide whether it is in accord with GUToB or standard theory (read: standard hypothesis).
Best wishes,
Peter
IP: Logged
|
|
nosivad
Member
Member # 767
|
posted 01. July 2003 07:12
I agree with Peter that chance has played an insignificant role in evolution. Evolution, like ontogeny, is an emergent phenomenon involving the derepression of information already present. I refer you to my ontogeny paper, a touch of your mouse away at my home page www.uvm.edu/~jdavison
I realize this is a bitter pill for the doctrinaire neoDarwinian to swallow. As George Bernard Shaw so aptly put it "All great truths begin as blasphemies". nosivad
IP: Logged
|
|
|
Printer-friendly view of this topic