|
Author
|
Topic: The GUToB
|
Pim van Meurs
Member
Member # 541
|
posted 01. July 2003 11:29
Peter: First and foremost --and as mentioned before-- the evolutionary claims from microbe to man is far more extraordinary than my claim that mutations line up due to common mechanisms, i.e. same DNA sequence plus same biochemistry yields similar mutations with respect to position and nucleotide. If you don't agree please explain why you think so.
That 'mutations line up' is hardly extraordinary but your claims go beyond this and suggest that such lining up would give evidence of false common descent. Your claims about NRM are hardly extraordinary since they are part of RM&NS, namely mutations are not necessarily random wrt location/time etc.
But your unsupported assertions about the implications of this are. Thus the request to support them with something more than 'it's obvious' because what may be 'obvious' need not be...
Davison suggests that "I realize this is a bitter pill for the doctrinaire neoDarwinian to swallow." but has failed to show that the NeoDarwinian has any such bitter pill to swallow when in fact data and theory seem to be quite well in support of his views. So far the bitterness seems to emanate not from the NeoDarwinians I might add. [ 01. July 2003, 11:31: Message edited by: Pim van Meurs ]
IP: Logged
|
|
nosivad
Member
Member # 767
|
posted 01. July 2003 17:38
Pim, I sure hope you don't think I am bitter about anything. I'm having the time of my ancient life! nosivad
IP: Logged
|
|
Mesk
Member
Member # 630
|
posted 02. July 2003 00:34
Peter,
I feel that our discussion of the ACTN genes has reached an impasse, which is why I have not responded further. Several times now I have explained why the signature of purifying selection on ACTN3 is perfectly consistent with evolutionary theory, since there is no reason to believe that ACTN3 is or has ever been redundant, and there is in fact excellent evidence suggesting otherwise (see the mouse expression data in the Mills et al. 2001 paper, and our athlete article which has now been accepted for publication in the September edition of American Journal of Human Genetics). Each time I pointed this out you have determinedly ignored it, in favour of simply repeating your earlier assertions. Since you appear to have neither valid argument nor empirical evidence to back your claims, there appears to be no constructive reason to continue the discussion. If you believe I am mistaken about this, feel free to continue the discussion by submitting your arguments and the supporting evidence to a peer-reviewed journal. I will be more than happy to address your claims in that arena.
I am also tiring of the rest of this thread, in which you continue to repeat multiple unsupported claims despite having them effectively dismantled on several occasions. Rex has more than ably shown that your claims regarding potential effects of NRM on phylogeny are false, and I have pointed out that your current arguments entail several fundamental self-contradictions that render them utterly invalid. Several of us have also pointed out on numerous occasions that your theories lack essentially all of the requirements of a scientific approach: your claims are vague, ill-defined and often contradictory; your theories appear to entirely lack both predictive ability and explanatory power; you have outlined no objective protocols for testing your hypotheses; and you have absolutely no statistical method for determining if results actually support your claims. Despite these glaring insufficiencies, you continue to describe your ideas as if they posed any serious challenge to mainstream theories. Reality check, Peter: they don't. Without a clearly formulated hypothesis and both experimental and statistical approaches for testing this hypothesis, you're not even a contender.
So how about you spend some time thinking about your ideas instead of blindly repeating them, and come back when you have both some semblance of a coherent theory and a valid experimental approach to testing it. Until then you're simply wasting the time of everyone involved in this thread, and I'm sure some of us have much more useful things we could be doing - like, say, some real science.
Good luck, Peter.
Mesk.
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 02. July 2003 01:41
hi Mesk,
I wonder, why did you ever register to this DISCUSSION board?
It really puzzles me why you cannot address my specific comments on the ACTN genes while you have all data available. You could even write a paper about NRM in the ACTN genes and their implications. And try to get it in a peer reviewed journal....
Anyway I wish you good luck with your studies. I will await the papers in the literature.
Best wishes, Peter
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 02. July 2003 03:11
Once more to proof my point:
Sequences from Schmidt and Tautz (PNAS 1997)
code:
D. mel 1 AGAAATTGTATTGATTAGTGGGAAGAAAGCCTCACAGGCACACAGAGGCGGGGGTAACAATTCTGCGAGAAGGTT D. mel 2 .............................G............................................. D. mel 3 .............................G................A....................T....... D. mel 4 .............................G............................................. D. mel 5 .............................G............................................. D. mel 6 .............................G............................................. D. mel 7 ..........A..GG..A.A.........G............................................. D. mel 8 .............................G.............................T......A.....T.. D..mel 9 ..........A..GG..A.A..............................................A........ D. mel 10 .............................G.....................................T....... D. mel 11 .............................G............................................. D. mel 12 ..........A..GG..A.A....................................................... D. mel 13 .............................G.............................................
A reordering for exactly the same sequences gives:
code:
000000000111111111122222222223333333333444444444455555555556666666666777777 123456789012345678901234567890123456789012345678901234567890123456789012345 D. mel 13 AGAAATTGTATTGATTAGTGGGAAGAAAGGCTCACAGGCACACAGAGGCGGGGGTAACAATTCTGCGAGAAGGTT D D. mel 2 ........................................................................... 0 D. mel 4 ........................................................................... 0 D. mel 5 ........................................................................... 0 D. mel 6 ........................................................................... 0 D. mel 11 ........................................................................... 0 D. mel 1 .............................C............................................. 1 D. mel 10 ...................................................................T....... 1 D. mel 3 ..............................................A....................T....... 2 D. mel 7 ..........A..GG..A.A....................................................... 6 D. mel 12 ..........A..GG..A.A.........C............................................. 7 D..mel 9 ..........A..GG..A.A.........C....................................A........ 8 D. mel 8 ...........................................................T......A.....T.. 3
Now the evolutionary claim would be that D. mel 13, 2, 4, 5, and 6 are most closely related and share a recent common ancestor. Secondly, the claim will be D. mel 7, 12 and 9 have a common ancestor and thirdly, D mel 10 and 3 share a common ancestor. This is all based upon the shared mutations.
This effect ("illusion of common descent") would even be stronger if you mis a couple of sequences you get:
code:
D. mel10 ...................................................................T....... D. mel 3 ..............................................A....................T....... D. mel 7 ..........A..GG..A.A....................................................... D. mel12 ..........A..GG..A.A.........C............................................. D..mel 9 ..........A..GG..A.A.........C....................................A........ D. mel 8 ...........................................................T......A.....T..
Now the illusion would even be stronger. However, the region is a neutral region and the organism live on different continents.
So, in conclusion the authors missed two very important observations: 1) the gene does not change fast (most mutations are in the introns). It is almost stable within the D mel population.
2) and when mutations are observed the mutations are introduced NON RANDOMLY and give the illusion of common descent. For the last time: the region is a neutral region according to the authors!! So, the only explanation can be a mechanism that introduces the mutations nonrandomly since selection is excluded.
Why do the authors mis these VERY important phenomena?
Best wishes, Peter
IP: Logged
|
|
nosivad
Member
Member # 767
|
posted 02. July 2003 08:27
As for "mainstream theories" like Phlogiston, the Ether and Selection, they have all been proved wrong with laboratory experiments. The letters may also be rearranged to be ESP, extrasensory perception indeed. nosivad
IP: Logged
|
|
|