ISCID Forums


Post New Topic  Post A Reply
my profile | search | faq | forum home
  next oldest topic   next newest topic
» ISCID Forums   » General   » Brainstorms   » Nature reports on Intelligent Design, University Research Ideas (Page 1)

 
This topic is comprised of pages:  1  2  3  4 
 
Author Topic: Nature reports on Intelligent Design, University Research Ideas
Salvador T. Cordova
Member
Member # 959

Icon 1 posted 28. April 2005 22:00      Profile for Salvador T. Cordova     Send New Private Message       Edit/Delete Post 
In as much as ISCID is a forum for discussing the scientific aspects of design, I open this brainstorm thread for exploring what empirical and theoretical exercises students can conduct to help further the understanding and research of the design hypothesis.

The advance of design theory is arriving at the universities, and thus areas of novel research and are in order, as well as re-visiting prior research and concepts.

I open this thread to post suggestions for brainstorms about student research projects.

For what it's worth, as I feel it is noteworty, see the article in Nature, Intelligent Design in the Universities. An ARN discussion of it's political implications is at:

Salvador in Nature

[ 29. April 2005, 11:04: Message edited by: Salvador T. Cordova ]

IP: Logged
Jerry D. Bauer
Member
Member # 756

Icon 1 posted 28. April 2005 23:34      Profile for Jerry D. Bauer   Email Jerry D. Bauer   Send New Private Message       Edit/Delete Post 
I caught that, Sal. Scientific American, Physics Today, National Geographic, now Nature....the news is out wall to wall and I was much surprised to see Nature comment that something like 75% of college students would like to take a course in ID (I believe they were quoting your survey).

How far away are some from an outright attempt at suppression of knowledge to deny students from actively pursuing it?

Here, I think, is the next great debate.

IP: Logged
Salvador T. Cordova
Member
Member # 959

Icon 1 posted 09. May 2005 13:12      Profile for Salvador T. Cordova     Send New Private Message       Edit/Delete Post 
A very good set of experiments for undergraduates would be to formulate methods for making designs whose primary end it to let the observer known the artifact is designed.

This may seem innocuous enough, but onece one starts designing things at the molecular level, one starts to see designs that look astonishingly like biotic reality!

When I gave an ID lecture at James Madison Univerisity recently, I was astonished how many felt design was not detectable. Two physics students, quite sincere, I might add, were disbelieving. I suggested they construct such experiemnts using dice for starters. They began to see my point after they thought about it.

One thing I see a need for is basic exercises in to help them understand the meaning of specified complexity. Such experiments are very enlightening.

[ 09. May 2005, 21:09: Message edited by: Salvador T. Cordova ]

IP: Logged
Art
Member
Member # 179

Icon 1 posted 09. May 2005 23:28      Profile for Art     Send New Private Message       Edit/Delete Post 
Try calculating the specified information of one of the four hands in a deal of bridge.
IP: Logged
Jerry D. Bauer
Member
Member # 756

Icon 1 posted 10. May 2005 05:22      Profile for Jerry D. Bauer   Email Jerry D. Bauer   Send New Private Message       Edit/Delete Post 
quote:
Try calculating the specified information of one of the four hands in a deal of bridge.
I did. There ain't any. Next? [Wink]
IP: Logged
andyg
Member
Member # 415

Icon 1 posted 16. May 2005 18:48      Profile for andyg         Edit/Delete Post 
quote:
I did. There ain't any. Next?
Sure. Tell me them amount of CSI in these four strings.

1.

atactgcgtcataagtaatctctattagacaaagatttcattacctgttggcatattgca
aaaataacaccaatacggaatcgtcatgttcacgattaaaacagatgatctcacccatcc
agcagtgcaagcattagtggcttaccatatttccggcatgctgcagcagtctccccctga
aagcagtcatgctttagacgtgcaaaaattacgtaacccgacagtgacattctggtcagt
atgggaaggcgaacaactcgcaggaattggtgcgctgaagttgctggatgataaacatgg
cgaactgaaatcaatgcggaccgcgccaaattatttacgtcggggtgtcgccagtctgat
tttacgccacattttgcaggtcgcccatgacagatgccttcatcgcctgagtttagaaac
gggtacacaggctggatttacggcctgccatcaactttatttgaagcatggtttcgttga
ttgcgaaccgtttgccgattatcaacttgatccacacagtcgatttttgtcattgacgct
atgcgaagataatgagttgctttgagccagacgcagcacattcttgcattcgacgtgctg
cgtctttatttatcaccaacaggaaacgccttgtccatagacgccccttccacatgcgtc
acaagaaacctctattccagtgacacaattacgcctaattaattacatataatatttaat
tatgaattcctcaccatctattacatgctttttaaccatatcggaatatttatcataatc
ggcgggattcataacaatatattttcgctgcgatatttcatagcgaatccctgtaagggt
ccatggcattaaaaatgcctctttaataggattacatttcatacaaagtaattttaaatt
gccaggtatcgcaggaataacctcaatcttattatattcaatatacgcttctttcaaatt
tttggggaaccatctaatttctttaatattattctcactacaatcaaaaaccttagcggt

2.
gctatvcggatcgatcrgachacgcgccgttatctagcgatcg
acgatcgagcgccsgatcggcgtcatactgactcagtmcac
tcgatcagtcagvaaaacagtgragacgtcgagtasgtkag
cmhgsacacgtgatcygctagdtcgatcatgcatgcatgcg
atagtatgcgatghcatcgatgtcatgtgyacgttcatgtcaatn
cggscgatcgahtccavgctagcttgcagcachgctcgtgat
artantgatatgctgatgascgatcagtgatgagtcahgtcac
agtgtactacgatcgatgctgagctcttctttctagcvgatctagg
ctac

3.

actgnatgragswrathtggathytnytnathgcnatggayga
ratgwsnaarathtgygcnaayacngaygarttyathaayga
rtgywsnathacncarwsngcngtngarcayathwsnytn
athttygargatcnyrt

4.

atgccacctttaacaactaaaataacaggaagcaacaattacttttccttaatatctcttaacatcaatggtctcaactc
gccaataaaaagacatagactaacaaactggctacacaaacaagacccaacattttgctgcttacaggaaactcatctca
gagaaaaagatagacactacctcagaatgaaaggctggaaaacaattttccaagcaaatggtgtgaagaaacaagcagga
gtagccatcctaatatctgataagattgacttccaacccaaagtcatcaaaaaagacaaggagggacacttcattctcat
caaaggtaaaatcctccaagaggaactctcaattctgaatatctatgctccaaatacaagagcagccacattcactaaag
aaactttagtaaagctcaaagcacacattgcgcctcacacaataatagtgggagacttcaacacaccactttcaccaatg
gacagatcatggaaacagaaactaaacagggacacacggaaactaacagaagtggaaaaacattatgaactaaccagtac
ccctgagctcttgactctagctgcatatgtatcaaaagatggcctagtcggccatcactggaaagagaggcccattggac
acgcagactttgtgtgccccggtacaggggaacgccagggccaaagggggggagtgggtgatagaattgaacaaaaccat
ccaagatctaaaacaataaagaaatcacaaagggagacaactctggagatagaaatcctaggaaagaaatcaggaaccat
agatgtgagcatcagcaacagaatacaagatatgcaagagagaatctcaggtgcagaagattccatagaaaacatggaca
caacaatcaaagaaaatgcaaaatgcaaaaagatcctaactccaaacatccagaaaatccaggacacaatggtaagacca
aacctaaggataataggtatagatgagaatgaagattttcaacttaaagagccaataaatatcttcaaccaagttctaga
agaaatcttccctaaccaaaagaaagagatgcccatgaat

IP: Logged
Jerry D. Bauer
Member
Member # 756

Icon 1 posted 16. May 2005 22:06      Profile for Jerry D. Bauer   Email Jerry D. Bauer   Send New Private Message       Edit/Delete Post 
You are a lot of trouble. [Wink] Assuming those are valid sequences, and estimating each sequence (If you want to count all them dudes, you are welcome to. I counted out the first 50 and then estimated the rest by comparing lines of them to the size of my line of 50) I will use the math of Thaxton, Bradley and Olsen from The Mystery of Life's Origin: Reassessing Current Theories

quote:
For a protein, it is i =20, since a subset of twenty distinctive types of amino acids is found in living things, while in DNA it is i = 4 for the subset of four distinctive nucleotides.
We can use i to denote the microstates as well:

1) 1015 nucleotides, 4^1015 rounds to 10^611

Taking 10 base to the 2 base in order to meet Shannon's definition of bits:

Bits = Log10(10^611) / log10(2) = 2030 bits. This is complex specified information.

2.) 146 nucleotides, 4^146, rounds to 10^88.

No need to go any further this is not CSI.

3.) 152 nucleotides, 4^152, rounds to 10^92.

No need to go any further this is not CSI.

4.) 1106 nucleotides, 4^1106, rounds to 10^666.

2212 bits. This is complex specified information.

IP: Logged
andyg
Member
Member # 415

Icon 1 posted 17. May 2005 12:31      Profile for andyg         Edit/Delete Post 
What you seem to be saying is that the longer the string, the greater the likelihood of CSI. Correct? (Also, note that some of the sequences have more than four characters........)

What about a string that reads:

thishascsi

Does that have CSI?

[ 17. May 2005, 20:22: Message edited by: andyg ]

IP: Logged
Salvador T. Cordova
Member
Member # 959

Icon 1 posted 17. May 2005 22:52      Profile for Salvador T. Cordova     Send New Private Message       Edit/Delete Post 
andyg,

The question you posed does not have sufficient ifnormation. For CSI to exists one must establish:

1. Physical Information
2. Conceptual Information
3. Coicidence of #1 and #2

the way you phrased your question does not supply enough information to make an inference. Dembski's No Free Lunch outlines the requirements for making such a determination.

The experiments I propose for college students will help them first of all determine if they have sufficient information to even begin making a decision. The strings you provided are not sufficient to make an inference, therefore, "inconclusive" is the proper inference.

IP: Logged
Jerry D. Bauer
Member
Member # 756

Icon 1 posted 18. May 2005 00:58      Profile for Jerry D. Bauer   Email Jerry D. Bauer   Send New Private Message       Edit/Delete Post 
No Andy, that's not CSI. I don't think you understand what CSI is.

The ISCID Encyclopedia might help you with this:

http://www.iscid.org/encyclopedia/Specified_Complexity

We're always glad to help you if you have further questions.

IP: Logged
andyg
Member
Member # 415

Icon 1 posted 18. May 2005 12:26      Profile for andyg         Edit/Delete Post 
Dembski wrote in 1997 that a person's telephone number constitutes CSI, since "the complexity ensures that this number won't be dialed randomly (at least not too often), and the specification ensures that this number is yours and yours only".

When did he change his defintion of CSI?

You still seem be suggesting that a sufficiently long string will have CSI if the probability of it occurring is lower than 10E150. Is this correct?

IP: Logged
Salvador T. Cordova
Member
Member # 959

Icon 1 posted 18. May 2005 17:23      Profile for Salvador T. Cordova     Send New Private Message       Edit/Delete Post 
Hi Andy,

Bill did not change his definition. Do you have Dembski's books, if so which ones, and I'll walk you through your questions.

If you are willing to learn the defintions, I can even walk you through the expermiments if you're interested.

For your sake, it would be good for you to state the definition of CSI, if you have Dembski's book. The way you phrased your earlier question indicates that perhaps CSI is not what you think it is.

Salvador

IP: Logged
andyg
Member
Member # 415

Icon 1 posted 18. May 2005 17:42      Profile for andyg         Edit/Delete Post 
I'm trying to get clear in my head the difference between what Jerry is saying

quote:
And yes, longer sequences are more specified. When a sequence reaches 500 bits, this becomes CSI.

and in response to my question about whether the string "thishascsi" has CSI.

quote:
No Andy, that's not CSI
and what Dembski is saying. I think Jerry is wrong. According to Dembski, the string "thishascsi" does in fact have CSI, because it has high information content and conforms to a pattern, namely a recognizable English phrase. Whether Dembski's telephone number fits this definition is not clear to me.
IP: Logged
Jerry D. Bauer
Member
Member # 756

Icon 1 posted 18. May 2005 21:51      Profile for Jerry D. Bauer   Email Jerry D. Bauer   Send New Private Message       Edit/Delete Post 
Andy,

That information must be larger than 500 bits. That string is simply nowhere close to this.

Also, although Dembski is certainly recognized by ID theorists as perhaps the greatest contributor of all time to the field of study, his word is not final on anything.

Others in ID will try to falsify his work and add to it, and some HAVE added to it. That's the way the scientific method is supposed to work, isn't it? [Wink]

IP: Logged
Art
Member
Member # 179

Icon 1 posted 18. May 2005 22:42      Profile for Art     Send New Private Message       Edit/Delete Post 
quote:
quote:
Art: Try calculating the specified information of one of the four hands in a deal of bridge.
Jerry: I did. There ain't any. Next?
Nice try, but no cigar.

Any other takers?

FWIW, IMO, if one cannot answer this question, one isn't ready to tackle the issue of (C)SI in biology.

IP: Logged


All times are East Coast
This topic is comprised of pages:  1  2  3  4 
 
Post New Topic  Post A Reply Close Topic    Move Topic    Delete Topic    Top Topic next oldest topic   next newest topic
 - Printer-friendly view of this topic
Hop To:

Contact Us | ISCID

All content © ISCID and content contributor 2001-2003

The ISCID Forums are aimed at generating insight into the nature of complex systems (e.g. biological complexity, organizational complexity, etc.) and the ontological status of purpose, especially from the vantage point of various information- and design-theoretic models.

Indexed by UBB Spider Hack  |  Powered by Infopop Corporation UBB.classicTM 6.3.1.1

PCID | Encyclopedia | Brainstorms | The Archive | News | Essay Contests | Chat Events | Membership