Robert_js
Member
Member # 1911
|
posted 18. March 2006 06:56
I put up my original post on Irreducible Complexity in haste. It was written for another forum and did not really address the issues I would like to argue here.
I have deleted the original and the revised post is as follows -:
Irreducible Complexity
Having thought about this issue of “irreducible complexity” I am currently of the opinion that it is not the best way to make the case for intelligent design. I support fully the ID concept but not always the way the argument is put.
Let me first say that I believe it is very likely that all living systems are irreducibly complex. But the counter argument (there were no big jumps that can not be explained by the gradualists approach) may be true. I am of course currently of the opinion that this argument for gradualist evolution is wrong. If however evidence was presented (that at present does not exist) and I could be convinced it was true I would still argue for there being a designer.
I am not sure it is possible to convince Darwinists they are wrong. You can try asking them -:
· Where did all the matter come from?
· Where did all the heat in 10,000,000,000,000,000,000,000 stars come from?
· Where did the gravitational force that holds it all together come from?
This will normally get a blank look and a diversion to a so-called scientific debate. I am reluctant to proceed from this point unless there is an acknowledgement that the three points above can not be explain and that there must be more to it than Darwinian coin flips. Despite the overwhelming logic of the above I have (at the age of 58 years) never had a single concession from a committed Darwinist.
So debating Darwinists on their own turf is a tempting alternative. I have found they are pathetically weak in many areas but most vulnerable on the topic of abiogenesis. The following is my normal approach -:
Abiogenesis
Before life existed on earth there must have been a jump from a non living system to a living system. We know that living systems can organize themselves and form complexity but before life there was nothing to do this. So before there were any living systems there had to be a non living system that had enough complexity to kick start life. Even now when we know the genetic code for life; and with many years of trying we have not got close to building a system that can create life. So the question is not whether complex systems can trace their origins back to non complex systems. The question is; how did that first system (that needed to be complex enough to kick start life) come into existence?
Watson and Crick revealed the structure of DNA in 1953 but 53 years later (with the formula of life in hand) no one has successfully created life in the laboratory. My argument is that the jump from “no life” to “life” needed to benefit from a complex system. And the point here of course is that before there was life there could have been no Darwinian natural selection to design the first complex system that got life up and running.
For the sake of the following I will assume conventional science is correct when it argues that all matter was created (without an intelligent designer) in the big bang. I will also allow that there is a rational (scientific) reason for all the heat in stars and the gravitational forces that hold it all together. The only concession I ask is that the system that first got life started was not a simple 5 or 6 nucleotides that fell together by accident. We do not know of any life form that can find its own food source (and reproduce) that is this simple. With the structure of DNA revealed over 50 years ago (and still not being able to create life in the laboratory) it is reasonable to speculate that this be a more complex system.
So what sort of system might have got life started? Man has built massive computers and space shuttles but not a system that can create life. A gene that codes for a simple protein will normally have more than 1,000 base pairs but in this exercise we will allow for 76 nucleotide bases (or 76 bases of A, C, T and G). But because the first system that created life could not have been driven by Darwinian natural selection then these 76 bases of A, C, T and G had to fall together by accident.
The problem we now have is that we do not know what the magical formulae for life might have been and how difficult it would have been to hit upon by accident. Again I will make a concession. I will allow for any sequence that is non random. It does not have to make sense or code for anything as long as it is a sequence that is non random. And I suggest that the least difficult way of doing this is to type out 38 bases of A, C, T and G in any sequence; then calculate the probability of accidentally typing out the second 38 of A, C, T and G in the exact same sequence.
For example -:
ACGTGCTACTGATGACTGACCTGAGATCATCGGACTTG
The above is gibberish. It is A, C, T and G typed out 38 times in a purely random sequence.
ACGTGCTACTGATGACTGACCTGAGATCATCGGACTTG
ACGTGCTACTGATGACTGACCTGAGATCATCGGACTTG
The above is a non random sequence. The second row is exactly the same as the first row. To accidentally copy out the second 38 bases in the exact same sequence as the first is a probability of one chance in 10,000,000,000,000,000,000,000; (or 1:10[-21]). But it is still not a complex system and will not code for anything. The above is merely a demonstration of the least difficult (least improbable) way of getting 76 bases of A, C, T and G to fall by accident into a non random sequence.
Let us imagine we needed to find by accident one grain of rice in a pile of 10(21) grains of rice. There are 1,000 grains of rice in a tablespoon full of rice (and 1,000 grains of rice = 20 grams). So 50 table spoons of rice is a kilo of rice and 50,000 grains. One ton of rice is therefore 50,000,000 grains. A pile of rice with 10(21) would therefore take 1,000 B-double trucks (50 ton trucks), taking one load an hour, 24 hours a day, 365 days a year, 460,000 years to carry away.
Incidentally; 10(21) is also the number of stars in the universe. So if all those stars were grains of rice we would need 1,000 50 ton trucks, taking one load an hour, 24 hours a day, 365 days a year, 460,000 years to carry it all away. And all those stars were meant to have popped into existence without a creator.
Our gene sequence with 76 nucleotides is of course not the genetic code for life. It is just any sequence that is non random. Any larger non random sequence (or any sequence for creating the first life) would be far less probable.
IP: Logged
|
Printer-friendly view of this topic