|
Author
|
Topic: can some aspect of Darwinism be falsified?
|
John A. Davison
Member
Member # 1425
|
posted 21. April 2006 05:59
Shi
I understand what you are saying. I regard a PAST supernatural as undeniable and with that I am confdent you will agree. But that is all that can be stated with certainty. I feel it would be a waste of my time to attempt any further conclusions. Grasse stated my perspective very clearly and actually anticipated the Prescribed Evolutionary Hypothesis:
"Let us not invoke God in realities in which He NO LONGER HAS TO INTERVENE, The single absolute of creationj was enough for Him." The Evolution of Living Organisms, page 166, his emphasis.
So did Einstein:
"Everything is determined... by forces over which we have no control."
I regard the word "determined" as synonymous with "prescribed." Certainly that which IS determined must HAVE BEEN determined.
I hope this clarifies my position.
IP: Logged
|
|
John A. Davison
Member
Member # 1425
|
posted 21. April 2006 06:09
woops
That should read - single absolute ACT of creation. Incidentally, that is one conclusion about which I am not yet convinced. I am not at all certain that there was a single act of creation as several lines of evidence indicate otherwise. Similarly, I see no requirement for a single Creator. My own personal preference is for two, a benevolent one and a malevolent one, simply because it makes the world somewhat easier for me to understand.
IP: Logged
|
|
Shi
Member
Member # 1923
|
posted 21. April 2006 16:09
Hierarchy in evolution
A supernatural directed evolution must be goal oriented and that goal, by all appearances, seems to be the human mind, which may one day discover the supernatural by logic, reason, or mathematics. If the ultimate unique matter is an individual human brain, the widest deviations from it are the smallest and the largest matter of lowest complexity. Evolution may be broadly ordered into multiple hierarchical stages based on a gradual narrowing of the deviation from the ultimate, the creation of elements and stars/planets, the creation of genes and unicelluar life, the creation of multi-cellular life and animal body plans (phyla), the creation of species, and the creation of minds. The goal of the creator is to create an ultimate entity for each stage so that subsequent stages can proceed. The ultimate entity of the past stage will remain largely unchanged and will serve as building blocks in subsequent stages of evolution. At the stage of elements and stars/planets, the ultimate is the earth. Once that is achieved, the focus of the creator is shifted to create genes and life on that planet. The mind is the final stage where the goal is to create the ultimate mind that would uncover the law of evolution of the supernatural, which would in turn allow creation/evolution at the mind level to go on indefinitely.
Stability of past creation is essential for future evolution to go on. The sun earth cycle must be unchanging for billions of years in order for life on earth to evolve. The body plan or phyla must stay unchanged in order for species to flourish. At the mind era, the stability of species must be maintained in order for the mind to comprehend them. So, at the mind era, a lack of evolution at the species level is a necessity of the evolution law of the supernatural rather than a sign of lack of input from the supernatural. It just means that the input is now at a higher level, the mind.
So, John, you are right that no evolution at the species level is going on today. But you cannot deny evolution at the mind level. Furthermore, you cannot deny input from the supernatural in the present era of mind evolution. Granted that it is much harder for anyone to test or confirm the input at the mind level, since we do not know how to test. By logical reasoning, if the past eras of evolution involved the divine supervasion, there is no reason to believe that today's era of mind evolution can be totally free from direct influence from the divine.
It is very hard to comprehand how a single act of divine input can be enough. Multiple acts are much more reasonable. Many Darwinists accept God as someone who acted once in creating the big bang and what ever information is packed in the bang but who then had no impact on the subsequent evolution from the bang. In this sense, John, you are not much different from the Darwinists. Evolution is either guided or it is not. The single act of guidence is practically the same as no guidence at all.
IP: Logged
|
|
John A. Davison
Member
Member # 1425
|
posted 21. April 2006 20:52
Shi
You obviously do not believe in determinism or predestination. I do. So did Einstein. Intervention is quite unecessary in a properly designed goal-seeking, front-loaded system. If I am no better than the Darwinians, why then do they insist on pretending that I, like all my sources, do not exist?
IP: Logged
|
|
John A. Davison
Member
Member # 1425
|
posted 22. April 2006 02:45
Shi
There may very well have been several creations. Nobody knows. We do know now that all of the evolution in the order Pimates, to which we belong, can be accounted for by the restructuring of a common block of chromosomal structural information. There is no convincing evidence that new information was required for this transformation. For all I know each animal order was created separately although I certainly don't put much stock in such an idea. We should be more aware of what we do not know and be less inclined to make unjustified assumptions.
I have no idea what you mean by the evolution of the mind. The mind is part of the physical body and if that body is not evolving neither is the mind. Of course that is just my view about something concerning which very little is known for certain.
"Nothing is so firmly believed as what we least know." Montaigne
"Men are most to believe what they least understand." ibid
IP: Logged
|
|
Shi
Member
Member # 1923
|
posted 25. April 2006 13:05
John,
It is impossible to imagine that future evolution of the universe and life on earth can proceed free from influence by conscious observers, such as human beings. Since the arrival of humans on Earth, there have been little signs of major species evolution. As far as humans can tell, evolution in the post human period is mainly about progress in human's consciousness or understanding of nature. Indeed, conscious observers will play the dominant role in future evolution. If there is going to be any law that will govern future evolution, conscious observers must be an essential element of that law.
Ragardless of what kind of evolution law is employed in the past, there must be an evolution law for the future. Evolution is defined simply as change over time. The era of mind evolution is simply the evolution of human culture and civilization. Darwinism clearly does not apply to human mind/culture evolution. I dont see how PEH may apply. What we need to find is a law that applies to human mind/culture that include conscious observation as part of the law. Such a law may further help us formulate a more universal law that will include the supernatural conscious observer as part of the law.
If we assume that there is a single universal evolution law governing the past and future, a simple test of any evolution hypothesis is to see if it applies in human mind/culture evolution. If it does not, it must be false.
IP: Logged
|
|
John A. Davison
Member
Member # 1425
|
posted 25. April 2006 20:56
Shi
I feel there is neither any evidence nor any reason to believe that evolution must continue. That is nothing but wishful thinking like the belief in an afterlife. Everything points to a terminated process which has completely run it course. Just as ontogeny ends with death so evolution will end with extinction. It always has. Of that I am convinced. Believe whatever you want to believe. We all do.
Thanks for keeping the thread alive.
IP: Logged
|
|
Shi
Member
Member # 1923
|
posted 26. April 2006 13:30
To see if evolution has ended or not is to see if certain fundamental phenomenon of evolution has ended or not. I hope you will agree that creation (of novel things) is the most fundamental phenomenon of evolution. All things are created from sums/combinations of fundamental particles in a timely and orderly fashion (particles to elements/stars/planets to bacteria to animals to humans etc). So, the question is has creation stoped today? It is so in some sense in that no new species is being created today. It is not so however in terms of stars. It is also not so in terms of human mind. Just a casual look at the past human civilization will lead us to reliaze that the mind has always been creating. Indeed, the most unique aspect of human that distinguish it from other animals is its mind's ability to create. So, the creation phenomenon has not stoped today and will never stop as long as humans exist. So we need to discover a law that explains the creation phenomenon of the past, today and future. That law may be better termed the creation law. To call it an evolution law is also appropriate since evolution is nothing without the phenomenon of creation. So the challenge for humanity is to discover a universal creation law that will explain the never ending process of creation. A law that explains the past creation of animals but can not explain the creative activities of the mind simply has not explained the creation phenomenon and must be false.
IP: Logged
|
|
Shi
Member
Member # 1923
|
posted 26. April 2006 14:37
To continue the theme of my last post.
If one accepts that a supernatural creator created all that exist in nature, one must ask what kind of creation law she used. That law must explain creation at every level and at any time, from particles to elements/stars/planets, from earth to life, from animal life to human mind, from mind to the music of Mozart, the painting of Van Gough, the theory of Newton, or the endless future creations of the mind that may include perhaps a mathematical proof for the existence of the supernatural and a mathematical description of the creation law employed by the supernatural.
IP: Logged
|
|
Shi
Member
Member # 1923
|
posted 26. April 2006 15:24
By the way, when that universal creation law of the supernatural is finally discovered by human mind, it most likely will be a most inspiring law that human will love to follow to guide their everyday affairs. I cannot think of a more inspiring law than a law that tells humans that the purpose of the universe is to create or the purpose of the human life is to create. Existence and survival is merely a by product of creation. Anyway, it is obvious that a human's life is basically a unity of two activities, learning/fitting to rules created by others and being uniquely creative or setting the rules. A person is either creative or learning to be creative. Most people are fitters or followers but a few are creaters and hence immortal. So, to be immortal is to create. Existence or survival is a by product of creation. The only chance for human race to survive is for human to be creative or to find the law of creation of the supernatural that allows creation to happen.
Any creation or evolution law that offers a depressing future for humans is likely to be false. Surely, one could not imagine a wicked creator who created humans for the purpose of making human depressed. Anyway it will be irrelavant to humans since human has the capacity to know what is right and wrong and will keep searching for an inspiring law until they find one. Darwinism, by this standard, must be false since it tells humans that they exist only for the purpose of transmitting genes, no different from a bacteria. Human knows it to be wrong by intuition and common sense and social Darwinism (Darwinism applied in human affairs) has long been tossed by humans as garbage.
IP: Logged
|
|
John A. Davison
Member
Member # 1425
|
posted 27. April 2006 10:03
Shi
Meanwhile we destroy our environment with gay abandon. I do not share your optimism. I predict unprecedented disaster within this century.
IP: Logged
|
|
Shi
Member
Member # 1923
|
posted 27. April 2006 13:37
If we accept a supernatural creator that is timeless and forever existing, we must accept that there is a need on her part for her existence to be observed. The creator's existence has no meaning without an observer of her existence. I know I existed not because I can think or create but is because I can see logical reactions of other observers to my presence. If I do not receive any feedback signals from other human or animal observers indicating to me that I existed, I will have no way of knowing if I am real or just a ghost. The same might be true to the supernatural creator. In order for her to know for sure that she existed, she needs to create conscious observers that will give her feedback that she existed. If she wants to exist forever, she better make sure that her observers, ie, humans, will also exist forever. So, by this logic, as long as the supernatural is timeless, human will survive forever as long as they can find the creator by reason and give feedbacks to the creator before they self destruct. As long as the supernatural is capable, there is no way that she will allow humans to self destruct and in turn to destroy her only chance of knowing that she existed. She will make sure that humans will find her before they self destruct.
Existence has no meaning without being observed. For human existence to have meaning or purpose, it needs an observer, and the ultimate observer is the supernatural. For the supernatural to have meaningful existence, she also needs an observer which is human beings.
Based on the fact alone that creation is the most fundamental phenomenon of evolution or existence, it is easy and straight forward to conclude that the goal of evolution or existence is creation. Why creation then? Because it is the only way to exist or to exist forever. This is easy to understand from our common experience. The human beings that are immortal or will exist forever are those that have created somthing. Their immortality however depends on having humans to observe them and will vanish when there are no observers. For a creator that started out with no observers, her primary goal would be to confirm her own existence. Her only way to do that is to create in a step by step fashion leading to finally the creation of an observer. And her continued existence depends on the forever existence of the human observer and their creative activities leading to finding their creator or observer.
IP: Logged
|
|
|
|
peter borger
Member
Member # 722
|
posted 28. April 2006 07:36
Anybody for a clear-cut falsification of common descent at the molecular level? I know many so please let me know if you are interested in a demonstration. [ 28. April 2006, 07:39: Message edited by: peter borger ]
IP: Logged
|
|
peter borger
Member
Member # 722
|
posted 28. April 2006 08:04
Probably yes.
"Alu elements are primate-specific members of the short interspersed nucleotide element (SINE) retroposon family – short stretches of DNA present in the genomes of all primates but of unknown function. Approximately 10 percent of the human genome is made of Alu sequences. The abundance of Alu elements within human and primate genomes is the result of a “copy and paste” mechanism, in which RNA polymerase III generates a transcript that is reverse transcribed and put back into the genome. The integration of Alu sequences back into the genome is currently understood as an utter random phenomenon, and hence Alu sequences in the exact same location in primates that do not reproduce together qualify as independent evidence of Darwin’s principle of common ancestry. If this were true, we should not find deviations from “known” evolutionary lines of ancestry, as it would falsify common descent. If we would observe only one single Alu element violating Darwin’s principle we have another valid falsification of Darwin’s idea of common descent.
In 1999, Dale J. Hedges and coworkers reported the first comparison of Alu retroposons on a chromosome wide scale. They surveyed the human chromosome number 21 for Alu sequences and compared their positions to that found in the equivalent chimpanzee chromosome 22. The investigators found many species-specific copies of Alu sequences – some were found exclusively in humans, while others were solely present in chimpanzees. One Alu element, however, designated Alu CS12 was determined to be exclusive to gorilla and chimpanzee genomes and not present in humans. The authors commented that this was implying a relationship contrary to the orthodox phylogeny of ([human-chimp], [Gorilla]) [20]. Not really something to worry about, however, as it would not really upset common descent. The behavior of another Alu element, designated Alu HS6, was more of a concern. The Alu HS6 was present in human, gorilla and orang-utan but not in chimpanzee. This highly peculiar observation – as it is obviously defying common descent – prompted the investigators to consider the possibility of the specific excision of this Alu element from the chimpanzee’s genome.
quote: The HS6 insertions in human, gorilla, and orang-utan contained direct repeats that were identical in both sequence and length, strongly indicating identical by descent insertions. Unexpectedly, the chimpanzee locus was a perfect preintegration site, consisting of only one copy of the direct repeat. [[Hedges et al, Differential Alu mobilization and polymorphism among the human and chimpanzee lineages. Genome Research 1999, volume 14, pages 1068-75.]
As the precise excision of an Alu insertion appeared to be a remote possibility, the investigators explored other potential explanations for their observations, which they did NOT find. The figure below shows the DNA sequences surrounding the integration site of Alu HS6 in humans, the great apes and Owl-monkey (Aotus trivirgatus). The absence of the Alu HS6 in chimpanzees is not only sufficient to scientifically falsify the idea of common ancestry, it also questions the putative random integration of Alu elements and the presupposition that they serve no function and merely act as selfish elements." (excerpt from The GUToB, to be released)
code:
Human TGCCAATAGAGATAGAAAGAATGGATGGAACAGACATGCATTTAAGAAGGTTCA<Alu>AAGAAGGTTCAGCAGAGTGTGGTGAAGACTGGGC Chimpanzee TGCCAATAGAGATAGAAAGAATGGATGGAACAGACATGCATTTAAGAAGGTTCA----------------GCAGAGTGTGGTGAAGACTGGGC Gorilla TGCCAATAGAGATAGAAAGAATGGATGGAACAGACATGCATTTAAGAAGGTTCA<Alu>AAGAAGGTTCAGCAGAGTGTGGTGAAGACTGGGC Orangutan TGCCAATAGAGATAGAAAGAATGGATGGAACAGACATGCATTTAAGAAGGTTCA<Alu>AAGAAGGTTCAGCAGAGTGTGGTGAAGACTGGGC Owl Monkey TGCCAATAGAGAGAGAAAGAATGGATGGAACAGACATGGATTTAAGAAGGTTCA----------------GCAGAGTGTGGTGAAGACTGGGC
[ 28. April 2006, 08:15: Message edited by: peter borger ]
IP: Logged
|
|
|