ISCID Forums


Post New Topic  Post A Reply
my profile | search | faq | forum home
  next oldest topic   next newest topic
» ISCID Forums   » General   » Brainstorms   » Semi-Meiosis as an Evolutionary Mechanism (Page 2)

 
This topic is comprised of pages:  1  2  3  4 
 
Author Topic: Semi-Meiosis as an Evolutionary Mechanism
Scott
Member
Member # 1222

Icon 1 posted 06. May 2006 13:59      Profile for Scott   Email Scott   Send New Private Message       Edit/Delete Post 
John,

The first question is, do you have Adobe Acrobat Reader installed on your computer. If not, you will need to download and install it in order to be able to view .pdf files. I think it can be downloaded for free from http://www.adobe.com/reader/.

There are two ways to view a .pdf file that is on the web. One way is to right click on the link and choose the Save As option, and then open the saved file with Adobe Reader.

The other option is to click directly on the link. This option requires that you have the adobe reader plug-in installed for your browser. Which browser do you use?

This all assumes that you are not attempting to access a site that is somehow restricted at your location.

IP: Logged
John A. Davison
Member
Member # 1425

Icon 1 posted 06. May 2006 17:05      Profile for John A. Davison   Email John A. Davison   Send New Private Message       Edit/Delete Post 
Thanks Scott

I made a printout which makes it much easier for me to respond to any questions. That paper is 22 years old and I have forgotten some of what I said! However there is nothing there that I would retract either.

IP: Logged
Christopher D. Beling
Member
Member # 723

Icon 1 posted 09. May 2006 18:59      Profile for Christopher D. Beling     Send New Private Message       Edit/Delete Post 
Bruce
quote:
Could you please elaborate and clarify. Are you saying that there are no modern human remains at 40,000 years ago, or at 25,000 years ago? What kind of remains are there that date to 40,000 years, 50,000 years?
Yes my English was unclear. I meant that the present wisdom has it that the transition from Neanderthal to Modern humans was at 35,000 years ago (perhaps with an error margin of 5,000 years). Before 40,000 years ago there was only Neanderthal - as far as we can tell - since no modern human remains have been found dating from earlier times. Neanderthal lived from around 90,000 to 30,000years ago. [I have to say that I am perhaps a little skeptical about the dates - but only because I have not studied the methods of dating these remains - and also because I know radiocarbon dating does not go as far back to 30,000BP with any accuracy]

Peter
quote:
1) mtDNA mutates non-randomly
2) if we compare mtDNA of the great apes, the neanderthaler and (ancient) humans we observe that they all must have had a common ancestor around 150 thousand years ago.

Regarding (1) - how can we then use a mtDNA clock to extrapolate back in time. How can we trust that divergence time of a common ancestor in (2) i.e 150,000 years ago?
There are two things that you say here that make me reconsider the possibility that Modern man was born from Neanderthal in some saltation. Since mtDNA is non-random, we cannot make any strong assertion based on mtDNA that we did not come from Neanderthal. Secondly we cannot trust the 150,000 year ago divergence time, which throws doubt on the commonly held idea that we are cousins to Meanderthal (and just werent fortunate to leave any remains of our presence between 150,000BP to 30,000BP).

John
quote:
I also fail to see what that has to do with my paper.
Yes, I guess you are right about the date not being so important. But it is perhaps relevant to the SMH in that in this line of thought modern man could have been born out of homo-neanderthalis - am I not right? I also find it interesting that modern man has within his genome the gene for making hair over the whole body (similar to the apes) - in fact one Adrian Jeftichjew (known as the Russian dogman) was born with this gene accidentally turned on (probably by a reverse point mutation) in the 1800s (exact date unknown). I guess you could call this a redundant gene? Chris

[ 09. May 2006, 19:20: Message edited by: Christopher D. Beling ]

IP: Logged
John A. Davison
Member
Member # 1425

Icon 1 posted 09. May 2006 23:00      Profile for John A. Davison   Email John A. Davison   Send New Private Message       Edit/Delete Post 
Chris

One of the potential strengths of the PEH is that it has very few restraints. I see no problem with Neanderthal as our immediate ancestor especially in light of the absence of any alternative source. We sure had an organic origin. That is for certain. We also co-existed for quite some time. I think the simplest explanation is the most probable one.

IP: Logged
peter borger
Member
Member # 722

Icon 1 posted 10. May 2006 09:44      Profile for peter borger   Email peter borger   Send New Private Message       Edit/Delete Post 
quote:
Regarding (1) - how can we then use a mtDNA clock to extrapolate back in time. How can we trust that divergence time of a common ancestor in (2) i.e 150,000 years ago?

There are two things that you say here that make me reconsider the possibility that Modern man was born from Neanderthal in some saltation. Since mtDNA is non-random, we cannot make any strong assertion based on mtDNA that we did not come from Neanderthal.

If we believe that mtDNA randomly accumulates mutations and we look at the ancient human mtDNA HV sequences presented by Adcock in 2001 (Adcock GJ, et al. Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proc Natl Acad Sci USA 2001, volume 98, pages 537-542) we cannot excape the conclusion that humans, chimps, neandertaler, bonobo all have the same number of mutations. If we assume a constant substition for human mtDNA, they all lived around 150 thousand before present. See sequences below:

code:
                       00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198490413479368923448467803911780715672817 D Age (kY BP)
Modern Human CRS ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA - 0
Ancient Human (LM3) ....................T.G...........CT.T....T..T......TC....G 10 62
Ancient Human (LM4) .................T...........G................C............ 3 <10
Ancient Human (LM15) ....................T........................T.......C....G 4 0.2
Ancient Human (LM55) ...........G.......................T....................... 2 <10
Ancient Human (KS1) .C............T.....T.........................CG..T........ 6 10
Ancient Human (KS7) ..............T.....T..................T...........C....... 4 8
Ancient Human (KS8) ....................T.G..............TG.......C............ 5 8-15
Ancient Human (KS9) .C..................T..............T............C.........G 5 9
Ancient Human (KS13) .C............T.....T....C.G.................TC............ 7 8-15
Ancient Human (KS16) ....................T...................T.............C..C. 4 9-15

Bonobo ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC.. 29 0
Chimpanzee ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C.. 24 0
Neandertaler (FH) GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C... 27 30+

We can calculate the age to the alleged common ancestor of man and chimp in two distinct approaches of which the results are comparable and cast a remarkable light on the evolution of man. Compared to the modern human DNA sequence, ten mutations can be recognized in the ancient human DNA sequence that was dated 62 thousand years before present, and 24 mutations are present in the equivalent chimpanzee sequence. Because ten mutations were generated in 62 thousand, it may take 6’200 years for one mutation to occur. Extrapolating these results, which is allowed in an uniformitarian world, means that 24 mutations may have been generated in roughly 150 years. This uniformitarian extrapolation shows that the common ancestor to humans and chimps lived approximately 150 thousand years before present. Such observations are incomprehensible for evolutionism and I expect that they will always be found upon interspecies analyses that compare DNA of subpopulations of single species. That we share a very recent ancestor with chimpanzee is confirmed by a second approach. Let’s focus on specimens labeled LM3 and LM15. They are the oldest and youngest specimens, respectively. LM3 has been dated at 62 thousand years, while LM15 is roughly 200 years old. Both were isolated from remains retrieved from Lake Mungo. The sequences isolated from the oldest and youngest remains are genetically still closely related – four of the point mutations are shared. Over the years, LM3 accumulated 6 more point mutations in this region. Because, it has been calculated that LM15 and LM3 lived 62 thousands years apart it is save to conclude that the mutations frequency is 1 nucleotide per 10 thousand years. A difference in this region of 24 nucleotides, which is the difference between man and chimpanzee, confirms a very young age of the alleged common ancestor – 240 thousand years before present.

There is one more thing that becomes clear from the Adcock data. The difference between humans and chimpanzees, and humans and bonobo’s turned out to be 24 and 29 positions, while humans and Neanderthalers differ at 27 positions. Remarkably, the genetic difference between chimpanzee (Pan troglodytes) and its very closely related cousin bonobo (Pan paniscus) is 23 nucleotides, while that between chimpanzee and Neanderthaler is 24 nucleotides. This is all in the same range, meaning that all common ancestors lived around the same time.
[...]
The Adcock studies are superior to all other studies that compare primate and human mitochondrial chromosomes, because sequences in ancient human subspecies contain more information regarding the character of mutations. The ancient mitochondrial sequences provide more exact information about the mutation rate and the position where mutations are introduced. In the ancient individuals we are able to exactly follow mutations and mutation rates over a more accurate timescale. We do not have to invoke the assumption that humans and chimpanzee have a common ancestor and extrapolate mutation rates from primate data, because we compare sequences within one species. (FROM: GUToB)

Most likely the authors were simply comparing non-randomly introduced mutations. That would explain the data best.

peebee

[ 10. May 2006, 10:20: Message edited by: peter borger ]

IP: Logged
DaveScot
Member
Member # 1545

Icon 1 posted 10. May 2006 13:01      Profile for DaveScot   Email DaveScot   Send New Private Message       Edit/Delete Post 
Peter Borger

The case for instant evolution through HERVs was used and well elaborated in the plot of the award winning science fiction novel

"Darwin's Radio" by Greg Bear

It was reviewed quite favorably in March 2000 Nature by Michael Goldman who is the chair of the biology department at Cal State San Francisco.

Bear discusses the research that led up to his book here.

This probably deserves a topic of its own. I read the book in 2004 and it is what prompted my serious interest in ID and scrutiny of evolutionary dogma.

IP: Logged
John A. Davison
Member
Member # 1425

Icon 1 posted 10. May 2006 16:37      Profile for John A. Davison   Email John A. Davison   Send New Private Message       Edit/Delete Post 
I am not sure any predictions can be made if evolution is finished as Bateson, Grasse and Broom all postulated,and with which I am in strong agreement as you should know from my paper "Is evolution finished? If you had not purged all of my papers from the Uncommon Descent sideboard, papers that you had placed there, I could direct you to the source of that information right there where you serve as blogczar.

I have the distinct impression that you are attempting to embarrass me with a question which you already probably know the answer to. In case you have forgotten it goes this way.

In order ot test the semi-meiotic hypothesis with amphibian material it is necessary to find female frogs known to be heterozygous for one or more chromosome rearrangements. Anyone familiar with the SMH would of course know that. That I was unable to do. I was also during much of that time preparing manuscript for publication and digetsting a rich literature much of which I presented in my Manifesto which was discussed here at great length long ago. That lierature will never be reconciled with either the Darwinian model or the theistic interpretations characteristic of much of Uncommon Descent. The very name of that blog I find anathema because it implies that man was not organically derived.

I should also add that I have been banned from that blog twice, first by Dembski and then by DaveScot which I must assume is an alias for David Springer. I once again ask that DaveScot reinstate my papers on the side board at Uncommon Descent where he had originally placed them. I also ask that he place them in chronological order this time as it makes it much easier to understand the sequence that led to the Prescribed Evolutionary Hypopthesis, especially since that hypothesis is the subject of the present discussion.

I hope this seves to answer your question. Thanks for posting.

IP: Logged
John A. Davison
Member
Member # 1425

Icon 1 posted 10. May 2006 17:02      Profile for John A. Davison   Email John A. Davison   Send New Private Message       Edit/Delete Post 
DaveScot, an alias for David Springer I presume.

I am not sure any predictions can be made if evolution is finished as Julian Huxley, Pierre Grasse and Robert Broom all postulated and with which I am in strong agreement as you should know from my paper "Is evolution finished? If you had not purged all of my papers from the Uncommon Descent sideboard, papers that you had placed there, I could direct you to the source of that information right there where you serve as blogczar.

I have the distinct impression that you are attempting to embarrass me with a question which you already know the answer to. In case you have forgotten it goes this way.

In order to test the semi-meiotic hypothesis with amphibian or any other sort of material for that matter, it is necessary to find female animals known to be heterozygous for one or more chromosome rearrangements. Anyone even remotely familiar with the SMH would of course know that. Such females I was unable to obtain. I was also during much of that time preparing manuscripts for publication and digesting a rich antiDarwinian literature much of which I subsequently presented in my unpublished "An Evolutionary Manifesto" which was discussed here at great length long ago. That literature will never be reconciled with either the Darwinian model or the theistic interpretations characteristic of much of Uncommon Descent. The very name of that forum I find offensive because it implies that man is not an animal and was not reproductively produced.

I should also add that I have been banned from that forum twice, first by Dembski and then by DaveScot which I must assume is an alias for David Springer. I once again ask that DaveScot reinstate my papers on the side board at Uncommon Descent where he had originally placed them. I also ask that he place them in chronological order this time as it makes it much easier to understand the sequence that led to the Prescribed Evolutionary Hypopthesis, especially since that hypothesis is presumably the subject of the present discussion. There was absolutely no justification in removing 22 years of my published scholarship in the first place, especially since every one my papers is in complete concert with the notion of Intelligent Design, the major thrust of Dembski's forum.

I hope this seves to answer your question and perhaps to clarify the reasons you asked it.

Thanks for posting.

IP: Logged
DaveScot
Member
Member # 1545

Icon 1 posted 10. May 2006 17:13      Profile for DaveScot   Email DaveScot   Send New Private Message       Edit/Delete Post 
Doctor Davison

What is needed to obtain the genetic material to test the semi-meiotic hypothesis? In other words, if someone were to take up the task, what cost and effort would be necessary? Did you apply for a grant to do this yourself?

[ 12. May 2006, 03:38: Message edited by: DaveScot ]

IP: Logged
John A. Davison
Member
Member # 1425

Icon 1 posted 10. May 2006 19:37      Profile for John A. Davison   Email John A. Davison   Send New Private Message       Edit/Delete Post 
Of course I was never a full professor and never claimed to be one. Does that mean that I am not a Professor Emeritus from an institution at which I taught for thirty three years? The only criticism I ever made of Dembski is that I felt it was a mistake to present Intelligent Design as a subject for debate. After I was banned for the second time (no matter what you say) I decided, as anyone else would, to practice the old saw "When in Rome do as the Romans do." I always have and always will. I have no respect for anyone who would purge a man's published papers after that same person had proudly introduced and referred to them favorably no matter what he thought of their author. My history at Uncommon Desscent is very similar to my history at Panda's Thumb, ARN, EvC and Pharyngula. I find the fact that you had to pursue me here to brainstorms and deliberately pick a fight with me very revealing. What I or any other scientist did with his time is no ones concern and that you would even raise such a question is an indictment of your character.

The simple truth is that you have no credentials whatsoever to criticize anything I have ever written or done in my fifty years as a professional scientist. My publications speak for themselves and you have performed an inexcusable act by deliberately removing from the very forum where you had placed them. Your twisted rationalizations for your heinous behavior reveal your character and nothing more. I also remind everyone that what transpires at Dembski's forum is ultimately his responsibility. That includes the high handed actions of his personally appointed iron-fisted blog czar DaveScot, aka David Springer. Your reputation at Uncommon Dsscent is both well documented and well deserved.

Perhaps you should also remember that I gave every person in cyberspace an opportunity to present their version of the mechanism of organic evolution on my blog and nobody showed. That I regard as of great significance and have said so repeatedly.

None of this should have any effect whatsoever on the subject of these threads. But I can assure you that if you are allowed to pursue me wherever I post only to justify your own unprofessional behavior you will find that I will refuse to respond to your degenerate tactics. They speak for themselves.

Your refusal to restore my papers has been noted, recorded and found to be unjustified. What others may think of this revealing exchange means absolutely nothing to me. Why don't you just declare victory and retire from the field. You are contributing absolutely nothing to the discussion here by these personal attacks. Some here are interested in science not thoroughly unprofessional biopolitics and personal vilification. That would seem to be your primary forte. Practice it elsewhere. I regard you as pathetic.

IP: Logged
peter borger
Member
Member # 722

Icon 1 posted 11. May 2006 03:49      Profile for peter borger   Email peter borger   Send New Private Message       Edit/Delete Post 
Dave Scott,

The issue is HERVs are NOT viruses or remnants of ancient viruses. They may, however, become viruses after they have picked up the required genetic elements to escape and re-enter the cell. If you look at viruses it is clear that they still have the tools that HERVs have and additional genetic elements that make them virulent.

This can be concluded from syncitin, the gene that facilitates implantation of mamalian embryos. It was, of course not delivered by a virus, it is, of course, the other way around: the HERVs are proto-viruses (Compare: proto-oncogenes have not been designed to induce cancer, but may mutate to become cancerous. Likewise, HERVs have not been designed as viruses but they can become it).

HERV-W7q picked up the syncitin gene (which has been designed to facilitate embryonal embedding in the uturus wall) and now uses it as an envelope protein and is still hopping around with it. This view is supported by the RNA paradox: RNA viruses are NOT old, they share a Common Ancestor around 24 thousand years ago. More likely they have arisen independently due to a NON-RANDOM mutational mechanism. This is the GUToB explanation. GUToB explains it all).

Due to their atheistic phylosophy, evolutionists (darwinians in particular) tend to mess things up all the time, as they do not want to acknowledge that biology was the act of devine creation.

peebee

[ 11. May 2006, 07:29: Message edited by: peter borger ]

IP: Logged
John A. Davison
Member
Member # 1425

Icon 1 posted 11. May 2006 09:07      Profile for John A. Davison   Email John A. Davison   Send New Private Message       Edit/Delete Post 
Peter

It is much worse than that. The neo-Darwinians not only will not acknowledge the notion of Divine creation in any form, they pretend that anyone who would even suggest such a thing simply does not exist. No critics of the Darwinian fairy tale exist in a literature which has been completely dominated by atheist ideologues in the persons of such luminaries as Dawkins, Mayr, Provine and Gould. We must not and therefore cannot exist. It is the Darwinian way don't you know. Don't take my word for it. Examine the indexes and the bibliographies of their books, as I have, and draw your own conclusions.

IP: Logged
peter borger
Member
Member # 722

Icon 1 posted 11. May 2006 11:22      Profile for peter borger   Email peter borger   Send New Private Message       Edit/Delete Post 
John, I know,

Ernst Mayer, one of the Neodarwinian pioneers and contributor to the modern synthesis didn’t even refer to Kimura's neutral evolution, when he, at his 100th birthday, looked back at 80 years of evolutionary theory:

quote:
It would seem unjustified to assert that, so far, no revision of the Darwinian paradigm has become necessary as a consequence of the spectacular discoveries of molecular biology [Mayer E. Happy Birthday: 80 years of watching the evolutionary scenery. Science 2004, volume 305, pages 46-7.].

What a non-sense he was able to propagate in Science. (may God have mercy on him)

It is clear that in order to keep up their religious belief system Mayer and the other Darwinians ignore the advances made during recent decades.

peebee

[ 11. May 2006, 11:23: Message edited by: peter borger ]

IP: Logged
John A. Davison
Member
Member # 1425

Icon 1 posted 11. May 2006 14:28      Profile for John A. Davison   Email John A. Davison   Send New Private Message       Edit/Delete Post 
As Montaigne put it:

"We seek and offer ourselves to be gulled."

The Darwinian triumvirate of Mayr, Gould and Dawkin never gulled this investigator nor could they ever have gulled any of his sources.

Soren Lovtrup called Darwinism a deceit. I call it the biggest deliberate hoax in the history of science.

IP: Logged
DaveScot
Member
Member # 1545

Icon 1 posted 11. May 2006 16:03      Profile for DaveScot   Email DaveScot   Send New Private Message       Edit/Delete Post 
Peter

I don't see how what you stated about HERVs is contrary to Bear's hypothetical situation. Maybe it wasn't clear in the links I provided that HERVs cleaved off the human genome to become an infectious viral disease called SHEVA (Scattered Human Endogenous Retrovirus Activation). This viral disease, when contracted, caused a specific reorganization of human germ cell genomes and in this way caused a widespread speciation event in a single generation. Infected women had babies belonging to a new species. Bear hypothesizes this is how h.sapiens neanderthalensis speciated into h.sapiens sapiens in the past and it happens again in the present time to create h.sapiens novus. Maybe this link to another review will help clarify it.

P.S. There's only one T my name "Scot". It's a bit irritating that so many people think I don't know how to spell my own name.

IP: Logged


All times are East Coast
This topic is comprised of pages:  1  2  3  4 
 
Post New Topic  Post A Reply Close Topic    Move Topic    Delete Topic    Top Topic next oldest topic   next newest topic
 - Printer-friendly view of this topic
Hop To:

Contact Us | ISCID

All content © ISCID and content contributor 2001-2003

The ISCID Forums are aimed at generating insight into the nature of complex systems (e.g. biological complexity, organizational complexity, etc.) and the ontological status of purpose, especially from the vantage point of various information- and design-theoretic models.

Indexed by UBB Spider Hack  |  Powered by Infopop Corporation UBB.classicTM 6.3.1.1

PCID | Encyclopedia | Brainstorms | The Archive | News | Essay Contests | Chat Events | Membership